Structural Organisation in AnimalsNEET Zoology · Class 11 · NCERT Chapter 2

Solution

Dental formula of human adult (permanent dentition) = 2123 2123 . www.vedantu.com 16 Dental formula of child (primary dentition) = 2102 2102 So premolars and third molar (last molar) are absent in primary dentition.

Solution

Wall of intestine is composed of smooth muscle. Tendon is a dense regular white fibrous connective tissue and areolar tissue is a loose connective tissue. Tip of nose is made up of elastic cartilage. Lining of stomach is composed of columnar epithelium.

Solution

Synovial joints are freely movable joint which allow considerable movements. Pivot joint is a type of synovial joint which provide rotational movement as in between atlas and axis vertebrae of vertebral column.

Solution

In human, 12 pairs of ribs are present in which 7 pairs of ribs (1 st to 7th pairs) are attached dorsally to vertebral column and ventrally to the sternum.

Solution

Human dentition is characterized as thecodont, diphyodont, and heterodont. Thecodont refers to teeth set in sockets, diphyodont indicates two sets of teeth (deciduous and permanent), and heterodont means teeth of different shapes. NCERT XI chapter Structural Organisation in Animals describes these terms, so option (b) is correct.

Solution

Out of NCERT, Muscular dystrophy is an X linked recessive disorder.

Solution

Factual NCERT

Solution

Factual NCERT

Solution

Contact of sperm with egg causes completion of meiosis II

Solution

The new breed ‘Hisardale’ was formed by cross breeding Bikaneri ewes with Marino rams. Cross breeding involves mating individuals from different breeds to combine desirable traits, so option (c) is correct.

Solution

Cuboidal epithelium with a brush border of microvilli is found in the proximal convoluted tubule of the nephron, where it increases the surface area for reabsorption. NCERT XI chapter Structural Organisation in Animals describes this specific adaptation for enhanced reabsorption, so option (c) is correct.

Solution

- Floating Ribs are located between the second and seventh ribs and do not connect with the sternum, so they match with (i).
- Acromion is a part of the scapula that articulates with the clavicle, so it matches with (iii).
- Scapula is the shoulder blade, which does not directly connect with the ribs but is part of the shoulder girdle, so it matches with (ii).
- Glenoid cavity is the socket in the scapula that articulates with the head of the humerus, so it matches with (iv).

The correct option is (b).

Solution

Option (4) is the correct answer as neuroglia are a part of nervous tissue. • Neuroglia are the supportive cells of nervous tissue. They make up more than half the volume of neural tissue. Neurons, the unit of neural system are excitable cells. • Cartilage and blood are specialised type of connective tissues. • Adipose tissue is a type of loose connective tissue.

Solution

Option (2) is the correct answer because cartilage forming the intervertebral disc is present between the adjacent bones of the vertebral column and it is a type of cartilaginous joint. Option (3) is incorrect because areolar tissue present beneath the skin is a type of loose connective tissue. Option (4) is incorrect because smooth muscles are present in the visceral organs. Option (1) is incorrect because intercalated discs are characteristic feature of cardiac muscles present in heart.

Solution

Option (1) is the correct answer because Ciliated epithelium is mainly present in the inner surface of hollow organs like bronchioles and fallopian tubes. The function is to move particles or mucus in a specific direction over the epithelium. Some of the columnar or cuboidal cells get specialised for secretion and are called glandular epithelium. Goblet cells are unicellular glands. Tendons are dense regular connective tissues. They attach skeletal muscles to bones. Adipose tissue is a type of loose connective tissue located mainly beneath the skin. The cells of this tissue are specialised to store fats.

Solution

Ribosomes are composed of about 80 different proteins, as detailed in NCERT XI chapter Structural Organisation in Animals. This makes option (b) correct.

Solution

Both the assertion and the reason are true, and the reason correctly explains the assertion. The floral meristem develops from the shoot apical meristem, and the internodes condense to produce floral appendages instead of leaves, as described in NCERT XI chapter Structural Organisation in Animals. Therefore, option (b) is correct.

Solution

Lenticels are indeed lens-shaped openings for gas exchange, and bark refers to the periderm and secondary phloem. Early-formed bark is not specifically called hard bark, and phellogen is not necessarily single-layered. Therefore, statements A and D are correct, making option (c) the right choice.

Solution

Mitochondria, chloroplasts, and peroxisomes are not part of the endomembrane system. The endomembrane system includes the endoplasmic reticulum, Golgi complex, lysosomes, and vesicles, so option (c) is correct.

Solution

Ligaments are dense regular connective tissue, not irregular. Cartilage is avascular and less dense, not dense regular tissue. Both statements are false, so option (c) is correct. NCERT XI chapter Structural Organisation in Animals describes the characteristics of these tissues.

Solution

Statement I is incorrect because DNA is negatively charged, not positively charged, and is associated with positively charged proteins in the nucleoid. Statement II is true as it correctly describes the formation of nucleosomes in eukaryotes. Therefore, option (a) is correct.

Solution

- A. Mast cells are found in areolar connective tissue.
- B. The inner surface of bronchioles is lined with ciliated epithelium.
- C. Blood is a specialized connective tissue.
- D. The tubular parts of nephrons are lined with cuboidal epithelium.

Solution

The cytoskeleton provides structural support and enables cell motility by forming a network of filaments that can contract or change shape. NCERT XI chapter Structural Organisation in Animals highlights the role of the cytoskeleton in cell movement, so option (d) is correct.

Solution

During anaphase, the centromeres split and chromatids separate, and during telophase, the nucleolus, Golgi complex, and ER are reformed. Tetrad formation is seen during zygotene, terminalization occurs during diplotene, and crossing over takes place between non-sister chromatids of homologous chromosomes, so option (c) is correct.

Solution

The coding strand of DNA is complementary to the mRNA. The mRNA sequence 5’ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3’ corresponds to the DNA coding strand 5’ ATCGATCGATCGATCGATCG ATCGATCG 3’, so option (d) is correct.

Solution

• Nucleolus is a site for active ribosomal RNA synthesis • Both the centrioles in a centrosome lie perpendicular to each other in which each has an organisation like the cartwheel. • Leucoplasts are the colourless plastids of varied shapes and sizes with stored nutrients. • Golgi apparatus is the important site for formation of glycoproteins and glycolipids. - 50 - NEET (UG)-2024 (Code-Q1)

Solution

The correct answer is option no. (3) as A. Unicellular glandular epithelium (III) Goblet cells of alimentary canal B. Compound epithelium (IV) Lines moist surface of buccal cavity C. Multicellular glandular epithelium (I) Salivary glands D. Endocrine glandular epithelium (II) Pancreas

Solution

The primary function of Golgi apparatus is to package the materials made by endoplasmic reticulum and deliver it to intracellular targets and outside the cell, this statement is correct and the reason statement is also correct.

Golgi apparatus remains in close association with endoplasmic reticulum. Here, assertion and reason statements both are correct but reason is not correctly explaining assertion.