NEET PYQs · 2023 · Code H4

NEET 2023 — Code H4

Official NTA NEET-UG 2023 question paper, set H4. 196 questions across Physics, Chemistry, and Biology with worked solutions and the official answer key.

An electric dipole is placed at an angle of 30° with an electric field of intensity 2×10⁵ N C⁻¹. It experiences a torque equal to 4 N m. Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm.

(1)

4 mC

(2)

2 mC

(3)

8 mC

(4)

6 mC

Show answer & solution
Answer: B

A bullet is fired from a gun at the speed of 280 m s⁻¹ in the direction 30° above the horizontal. The maximum height attained by the bullet is (g = 9.8 m s⁻², sin 30° = 0.5):

(1)

1000 m

(2)

3000 m

(3)

2800 m

(4)

2000 m

Show answer & solution
Answer: A

The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly: (surface tension of soap solution = 0.03 N m⁻¹)

(1)

01×10⁻⁴ J

(2)

50.1×10⁻⁴ J

(3)

30.16×10⁻⁴ J

(4)

5.06×10⁻⁴ J

Show answer & solution
Answer: A

The half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to (1/16)th of its initial value?

(1)

60 minutes

(2)

80 minutes

(3)

20 minutes

(4)

40 minutes

Show answer & solution
Answer: B

A 12 V, 60 W lamp is connected to the secondary of a step down transformer, whose primary is connected to ac mains of 220 V. Assuming the transformer to be ideal, what is the current in the primary winding?

(1)

7 A

(2)

0.37 A

(3)

0.27 A

(4)

7 A

Show answer & solution
Answer: C

For Young’s double slit experiment, two statements are given below: Statement I: If screen is moved away from the plane of slits, angular separation of the fringes remains constant. Statement II: If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases. In the light of the above statements, choose the correct answer from the options given below:

(1)

Statement I is true but Statement II is false.

(2)

Statement I is false but Statement II is true.

(3)

Both Statement I and Statement II are true.

(4)

Both Statement I and Statement II are false.

Show answer & solution
Answer: A

The potential energy of a long spring when stretched by 2 cm is U. If the spring is stretched by 8 cm, potential energy stored in it will be :

(1)

8U

(2)

16U

(3)

2U

(4)

4U

Show answer & solution
Answer: B

In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of 2.0×10¹⁰ Hz and amplitude 48 V m⁻¹. Then the amplitude of oscillating magnetic field is : (Speed of light in free space = 3 × 10⁸ m s⁻¹)

(1)

6×10⁻⁶ T

(2)

6×10⁻⁹ T

(3)

6×10⁻⁸ T

(4)

6×10⁻⁷ T

Show answer & solution
Answer: D

A Carnot engine has an efficiency of 50% when its source is at a temperature 327° C. The temperature of the sink is :

(1)

100° C

(2)

200° C

(3)

27° C

(4)

15° C

Show answer & solution
Answer: C

A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is :

(1)

along north-east

(2)

along south-west

(3)

along eastward

(4)

along northward

Show answer & solution
Answer: A

The magnitude and direction of the current in the following circuit is

(1)

5/9 A from A to B through E

(2)

5 A from B to A through E

(3)

0.2 A from B to A through E

(4)

0.5 A from A to B through E

Show answer & solution
Answer: D

A metal wire has mass (0.4 ± 0.002) g, radius (0.3 ± 0.001) mm and length (5 ± 0.02) cm. The maximum possible percentage error in the measurement of density will nearly be:

(1)

6%

(2)

4%

(3)

2%

(4)

3%

Show answer & solution
Answer: A

Given below are two statements: Statement I : Photovoltaic devices can convert optical radiation into electricity. Statement II : Zener diode is designed to operate under reverse bias in breakdown region. In the light of the above statements, choose the most appropriate answer from the options given below :

(1)

Statement I is correct but Statement II is incorrect.

(2)

Statement I is incorrect but Statement II is correct.

(3)

Both Statement I and Statement II are correct.

(4)

Both Statement I and Statement II are incorrect.

Show answer & solution
Answer: C

A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?

(1)

Capacitor

(2)

Load resistance

(3)

A centre-tapped transformer

(4)

p-n junction diodes

Show answer & solution
Answer: A

In a series LCR circuit, the inductance L is 10 mH, capacitance C is 1 μF and resistance R is 100 Ω. The frequency at which resonance occurs is :

(1)

59 rad/s

(2)

59 kHz

(3)

15.9 rad/s

(4)

15.9 kHz

Show answer & solution
Answer: B

The ratio of radius of gyration of a solid sphere of mass M and radius R about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is :

(1)

2 : 5

(2)

5 : 2

(3)

3 : 5

(4)

5 : 3

Show answer & solution
Answer: B

An ac source is connected to a capacitor C. Due to decrease in its operating frequency :

(1)

displacement current decreases.

(2)

capacitive reactance remains constant

(3)

capacitive reactance decreases.

(4)

displacement current increases.

Show answer & solution
Answer: A

The magnetic energy stored in an inductor of inductance 4 μH carrying a current of 2 A is :

(1)

8 mJ

(2)

8 μJ

(3)

4 μJ

(4)

4 mJ

Show answer & solution
Answer: B

The temperature of a gas is –50° C. To what temperature the gas should be heated so that the rms speed is increased by 3 times?

(1)

3097 K

(2)

223 K

(3)

669° C

(4)

3295° C

Show answer & solution
Answer: D

In hydrogen spectrum, the shortest wavelength in the Balmer series is λ. The shortest wavelength in the Bracket series is :

(1)

9 λ

(2)

16 λ

(3)

2 λ

(4)

4 λ

Show answer & solution
Answer: D

If ∮_S E⃗ ⋅ dS⃗ = 0 over a surface, then :

(1)

all the charges must necessarily be inside the surface.

(2)

the electric field inside the surface is necessarily uniform.

(3)

the number of flux lines entering the surface must be equal to the number of flux lines leaving it.

(4)

the magnitude of electric field on the surface is constant.

Show answer & solution
Answer: C

If the galvanometer G does not show any deflection in the circuit shown, the value of R is given by : [Diagram: A circuit with a 10 V battery, a 400 Ω resistor, a resistor R, a galvanometer G, and a 2 V battery arranged in a bridge-like configuration.]

(1)

100 Ω

(2)

400 Ω

(3)

200 Ω

(4)

50 Ω

Show answer & solution
Answer: A

The net magnetic flux through any closed surface is :

(1)

Infinity

(2)

Negative

(3)

Zero

(4)

Positive

Show answer & solution
Answer: C

A vehicle travels half the distance with speed ϑ and the remaining distance with speed 2ϑ. Its average speed is:

(1)

4ϑ/3

(2)

3ϑ/4

(3)

ϑ/3

(4)

2ϑ/3

Show answer & solution
Answer: A

The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of V volts is proportional to:

(1)

1/V

(2)

(3)

√V

(4)

1/√V

Show answer & solution
Answer: A

Resistance of a carbon resistor determined from colour codes is (2200 ± 5%) Ω. The colour of third band must be :

(1)

Orange

(2)

Yellow

(3)

Red

(4)

Green

Show answer & solution
Answer: A

The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are :

(1)

Least count errors

(2)

Random errors

(3)

Instrumental errors

(4)

Personal errors

Show answer & solution
Answer: B

The venturi-meter works on :

(1)

The principle of parallel axes

(2)

The principle of perpendicular axes

(3)

Huygen’s principle

(4)

Bernoulli’s principle

Show answer & solution
Answer: D

The angular acceleration of a body, moving along the circumference of a circle, is :

(1)

along the tangent to its position

(2)

along the axis of rotation

(3)

along the radius, away from centre

(4)

along the radius towards the centre

Show answer & solution
Answer: B

The work functions of Caesium (Cs), Potassium (K) and Sodium (Na) are 2.14 eV, 2.30 eV and 2.75 eV respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV, which of these photosensitive surfaces may emit photoelectrons?

(1)

K only

(2)

Na only

(3)

Cs only

(4)

Both Na and K

Show answer & solution
Answer: C

The equivalent capacitance of the system shown in the following circuit is :

(1)

6 μF

(2)

9 μF

(3)

2 μF

(4)

3 μF

Show answer & solution
Answer: C

Two bodies of mass m and 9m are placed at a distance R. The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be (G = gravitational constant):

(1)

–16Gm/R

(2)

–20Gm/R

(3)

–8Gm/R

(4)

–12Gm/R

Show answer & solution
Answer: A

Light travels a distance x in time t₁ in air and 10x in time t₂ in another denser medium. What is the critical angle for this medium?

(1)

sin⁻¹(t₁/10t₂)

(2)

sin⁻¹(10t₁/t₂)

(3)

sin⁻¹(t₂/t₁)

(4)

sin⁻¹(10t₂/t₁)

Show answer & solution
Answer: B

Let a wire be suspended from the ceiling (rigid support) and stretched by a weight W attached at its free end. The longitudinal stress at any point of cross-sectional area A of the wire is:

(1)

W/2A

(2)

Zero

(3)

2W/A

(4)

W/A

Show answer & solution
Answer: D

The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is :

(1)

1 : 3

(2)

3 : 1

(3)

1 : 2

(4)

2 : 1

Show answer & solution
Answer: D

A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity 4 m s⁻¹. The ball strikes the water surface after 4 s. The height of bridge above water surface is (Take g = 10 m s⁻²) :

(1)

64 m

(2)

68 m

(3)

56 m

(4)

60 m

Show answer & solution
Answer: A

In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are thin)? n₁=1.5, R₁=R₂=20 cm, n₂=1.6

(1)

–100 cm

(2)

–50 cm

(3)

40 cm

(4)

–40 cm

Show answer & solution
Answer: A

The radius of inner most orbit of hydrogen atom is 5.3×10⁻¹¹ m. What is the radius of third allowed orbit of hydrogen atom?

(1)

59 Å

(2)

77 Å

(3)

0.53 Å

(4)

06 Å

Show answer & solution
Answer: B
39
None of the provided chapters in the list are relevant to the question about lenses and their focal lengths, which is a topic in physics, not chemistry. However, since the task requires returning a chapter name, and the question is not related to any of the chemistry topics listed, no chapter can be accurately

Two thin lenses are of same focal lengths (f), but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be :

(1)

f/2

(2)

Infinite

(3)

Zero

(4)

f/4

Show answer & solution
Answer: B

A satellite is orbiting just above the surface of the earth with period T. If d is the density of the earth and G is the universal constant of gravitation, the quantity 3π/(Gd) represents :

(1)

√T

(2)

T

(3)

(4)

Show answer & solution
Answer: C

10 resistors, each of resistance R are connected in series to a battery of emf E and negligible internal resistance. Then those are connected in parallel to the same battery, the current is increased n times. The value of n is :

(1)

1

(2)

1000

(3)

10

(4)

100

Show answer & solution
Answer: D

A wire carrying a current I along the positive x-axis has length L. It is kept in a magnetic field B⃗ = (2î + 3ĵ - 4k̂) T. The magnitude of the magnetic force acting on the wire is :

(1)

√5 IL

(2)

√3 IL

(3)

3 IL

(4)

5 IL

Show answer & solution
Answer: D

Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is 0.15 (g = 10 m s⁻²).

(1)

5 m s⁻²

(2)

50 m s⁻²

(3)

2 m s⁻²

(4)

150 m s⁻²

Show answer & solution
Answer: A

The net impedance of circuit (as shown in figure) will be: Circuit with 50/π mH inductor, 10/π μF capacitor, 10 Ω resistor, connected to 220 V, 50 Hz AC source.

(1)

5√5 Ω

(2)

25 Ω

(3)

10√2 Ω

(4)

15 Ω

Show answer & solution
Answer: A

An electric dipole is placed as shown in the figure. Dipole with –q and +q charges separated by 6 cm, point P located 5 cm from center along perpendicular bisector. The electric potential (in 10² V) at point P due to the dipole is (ε₀=permittivity of free space and 1/(4πε₀) = K):

(1)

(8/5)qK

(2)

(8/3)qK

(3)

(3/8)qK

(4)

(5/8)qK

Show answer & solution
Answer: C
46
None of the provided chapters in the list are relevant to the question about the magnetic field due to a current-carrying conductor, as this topic is typically covered under the subject of Physics, not Chemistry. However, since the task requires returning a chapter name, and given the context of the question,

A very long conducting wire is bent in a semi-circular shape from A to B as shown in figure. The magnetic field at point P for steady current configuration is given by : [Diagram: A straight wire segment with current i→ enters from left, bends into a semi-circular arc of radius R from point A to B, then continues as a straight wire segment with current i← exiting to the left. Point P is located at the center of the semi-circle.]

(1)

(μ₀i)/(4R)[1 - 2/π] pointed away from page

(2)

(μ₀i)/(4R)[1 - 2/π] pointed into the page

(3)

(μ₀i)/(4R) pointed into the page

(4)

(μ₀i)/(4R) pointed away from the page

Show answer & solution
Answer: A
47
None of the provided chapters are relevant to the question about simple harmonic motion and its x-t graph. However, since the question must be answered with a chapter name from the list, and considering the closest relevance to the physical concepts involved, the best match would be: Chemical Kinetics However,

The x-t graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the particle at t=2 s is : [Diagram: A graph of x (m) vs t (s). The curve is a sine wave starting at (0,0), peaking at (2,1), crossing zero at (4,0), reaching a trough at (6,-1), and returning to zero at (8,0).]

(1)

-π²/16 m s⁻²

(2)

π²/16 m s⁻²

(3)

π²/8 m s⁻²

(4)

-π²/8 m s⁻²

Show answer & solution
Answer: A

The resistance of platinum wire at 0°C is 2Ω and 6.8Ω at 80°C. The temperature coefficient of resistance of the wire is :

(1)

3×10⁻¹ °C⁻¹

(2)

3×10⁻⁴ °C⁻¹

(3)

3×10⁻³ °C⁻¹

(4)

3×10⁻² °C⁻¹

Show answer & solution
Answer: D

A bullet from a gun is fired on a rectangular wooden block with velocity u. When bullet travels 24 cm through the block along its length horizontally, velocity of bullet becomes u/3. Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is :

(1)

28 cm

(2)

30 cm

(3)

27 cm

(4)

24 cm

Show answer & solution
Answer: C

For the following logic circuit, the truth table is: Logic circuit with inputs A and B, each going through a NOT gate, then both outputs feeding into a NOR gate to produce output Y.

(1)

A B Y 0 0 1 0 1 0 1 0 1 1 1 0

(2)

A B Y 0 0 0 0 1 0 1 0 0 1 1 1

(3)

A B Y 0 0 1 0 1 1 1 0 1 1 1 0

(4)

A B Y 0 0 0 0 1 1 1 0 1 1 1 1

Show answer & solution
Answer: D

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: A reaction can have zero activation energy. Reasons R: The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy. In the light of the above statements, choose the correct answer from the options given below:

(1)

A is true but R is false.

(2)

A is false but R is true.

(3)

Both A and R are true and R is the correct explanation of A.

(4)

Both A and R are true and R is NOT the correct explanation of A.

Show answer & solution
Answer: B

Consider the following reaction and identify the product (P). CH₃ - CH - CH - CH₃ (with CH₃ below first CH and OH below second CH) + HBr → Product (P) 3 - Methylbutan - 2 - ol

(1)

CH₃ - CH - CH - CH₃ (with CH₃ below first CH and Br below second CH)

(2)

CH₃ - C - CH₂Br (with CH₃ above and below C)

(3)

CH₃ - C - CH₂ - CH₃ (with Br above C and CH₃ below C)

(4)

CH₃CH = CH - CH₃

Show answer & solution
Answer: C

The element expected to form largest ion to achieve the nearest noble gas configuration is:

(1)

N

(2)

Na

(3)

O

(4)

F

Show answer & solution
Answer: A

Select the correct statements from the following : A. Atoms of all elements are composed of two fundamental particles. B. The mass of the electron is 9.10939 × 10⁻³¹ kg. C. All the isotopes of a given element show same chemical properties. D. Protons and electrons are collectively known as nucleons. E. Dalton’s atomic theory, regarded the atom as an ultimate particle of matter. Choose the correct answer from the options given below :

(1)

A and E only

(2)

B, C and E only

(3)

A, B and C only

(4)

C, D and E only

Show answer & solution
Answer: B

Which one of the following statements is correct?

(1)

The bone in human body is an inert and unchanging substance.

(2)

Mg plays roles in neuromuscular function and interneuronal transmission.

(3)

The daily requirement of Mg and Ca in the human body is estimated to be 0.2 - 0.3 g.

(4)

All enzymes that utilise ATP in phosphate transfer require Ca as the cofactor.

Show answer & solution
Answer: C

Identify product (A) in the following reaction: [Chemical structure of a diketone with a benzene ring attached to a cyclohexane ring, undergoing reduction with Zn-Hg and conc. HCl to give (A) + 2H₂O]

(1)

Ethyl group attached to cyclohexane and ethyl group attached to benzene ring

(2)

OH attached to cyclohexane and OH attached to benzene ring

(3)

CH₃ attached to cyclohexane and CH₃ attached to benzene ring

(4)

CH₂OH attached to cyclohexane and CH₂OH attached to benzene ring

Show answer & solution
Answer: A

The conductivity of centimolar solution of KCl at 25°C is 0.0210 ohm⁻¹ cm⁻¹ and the resistance of the cell containing the solution at 25°C is 60 ohm. The value of cell constant is -

(1)

26 cm⁻¹

(2)

34 cm⁻¹

(3)

34 cm⁻¹

(4)

28 cm⁻¹

Show answer & solution
Answer: A

In Lassaigne’s extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with Fe³⁺ due to the formation of -

(1)

[Fe(CN)₅NOS]⁴⁻

(2)

[Fe(SCN)]²⁺

(3)

Fe₄[Fe(CN)₆]₃ · xH₂O

(4)

NaSCN

Show answer & solution
Answer: B

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: Helium is used to dilute oxygen in diving apparatus. Reason R: Helium has high solubility in O₂. In the light of the above statements, choose the correct answer from the options given below:

(1)

A is true but R is false.

(2)

A is false but R is true.

(3)

Both A and R are true and R is the correct explanation of A.

(4)

Both A and R are true and R is NOT the correct explanation of A.

Show answer & solution
Answer: A

Which of the following statements are NOT correct? A. Hydrogen is used to reduce heavy metal oxides to metals. B. Heavy water is used to study reaction mechanism. C. Hydrogen is used to make saturated fats from oils. D. The H-H bond dissociation enthalpy is lowest as compared to a single bond between two atoms of any element. E. Hydrogen reduces oxides of metals that are more active than iron. Choose the most appropriate answer from the options given below:

(1)

D, E only

(2)

A, B, C only

(3)

B, C, D, E only

(4)

B, D only

Show answer & solution
Answer: A

Identify the product in the following reaction: [Reaction scheme: benzene diazonium chloride reacts with (i) Cu2Br2/HBr, (ii) Mg/dry ether, (iii) H2O to give Product] Options show: (1) p-bromophenol, (2) phenol, (3) benzene, (4) phenylmagnesium bromide

(1)

p-bromophenol

(2)

phenol

(3)

phenylmagnesium bromide

(4)

benzene

Show answer & solution
Answer: D

Some tranquilizers are listed below. Which one from the following belongs to barbiturates?

(1)

Valium

(2)

Veronal

(3)

Chlordiazepoxide

(4)

Meprobamate

Show answer & solution
Answer: B

Given below are two statements: Statement I: A unit formed by the attachment of a base to 1' position of sugar is known as nucleoside. Statement II: When nucleoside is linked to phosphorous acid at 5'-position of sugar moiety, we get nucleotide. In the light of the above statements, choose the correct answer from the options given below:

(1)

Statement I is true but Statement II is false.

(2)

Statement I is false but Statement II is true.

(3)

Both Statement I and Statement II are true.

(4)

Both Statement I and Statement II are false.

Show answer & solution
Answer: A

The number of σ bonds, π bonds and lone pair of electrons in pyridine, respectively are:

(1)

11, 3, 1

(2)

12, 2, 1

(3)

11, 2, 0

(4)

12, 3, 0

Show answer & solution
Answer: A

Which of the following reactions will NOT give primary amine as the product?

(1)

CH₃NC →(i) LiAlH₄, (ii) H₃O⁺ Product

(2)

CH₃CONH₂ →(i) LiAlH₄, (ii) H₃O⁺ Product

(3)

CH₃CONH₂ → Br₂ / KOH Product

(4)

CH₃CN →(i) LiAlH₄, (ii) H₃O⁺ Product

Show answer & solution
Answer: A

The correct order of energies of molecular orbitals of N₂ molecule, is :

(1)

σ 1s < σ* 1s < σ 2s < σ* 2s < σ 2p_z < σ* 2p_z < (π2pₓ = π2pᵧ) < (π*2pₓ = π*2pᵧ)

(2)

σ 1s < σ* 1s < σ 2s < σ* 2s < (π2pₓ = π2pᵧ) < (π*2pₓ = π*2pᵧ) < σ 2p_z < σ* 2p_z

(3)

σ 1s < σ* 1s < σ 2s < σ* 2s < (π2pₓ = π2pᵧ) < σ 2p_z < (π*2pₓ = π*2pᵧ) < σ* 2p_z

(4)

σ 1s < σ* 1s < σ 2s < σ* 2s < σ 2p_z < (π2pₓ = π2pᵧ) < (π*2pₓ = π*2pᵧ) < σ* 2p_z

Show answer & solution
Answer: C

Which amongst the following options is correct graphical representation of Boyle’s Law?

(1)

Graph of P vs 1/V with three curves labeled T₁, T₂, T₃ where T₃ > T₂ > T₁

(2)

Graph of P vs T with three lines labeled V₁, V₂, V₃ where V₁ < V₂ < V₃

(3)

Graph of P vs V with three curves labeled T₁, T₂, T₃ where T₃ > T₂ > T₁

(4)

Graph of P vs 1/V with three lines labeled T₁, T₂, T₃ where T₃ > T₂ > T₁

Show answer & solution
Answer: D

Complete the following reaction : [A] (cyclohexanone) + HCN → [B] (cyanohydrin) → [C] (under conc. H₂SO₄, Δ) [C] is ________.

(1)

cyclohexene carbaldehyde

(2)

cyclohexene carboxylic acid

(3)

cyclohexanol

(4)

cyclohexanecarboxylic acid

Show answer & solution
Answer: B

Homoleptic complex from the following complexes is :

(1)

Pentaamminecarbonatocobalt (III) chloride

(2)

Triamminetriaquachromium (III) chloride

(3)

Potassium trioxalatoaluminate (III)

(4)

Diamminechloridonitrito - N - platinum (II)

Show answer & solution
Answer: C

Which amongst the following molecules on polymerization produces neoprene?

(1)

H₂C=CH−C≡CH

(2)

H₂C=C(CH₃)−CH=CH₂

(3)

H₂C=CH−CH=CH₂

(4)

H₂C=C(Cl)−CH=CH₂

Show answer & solution
Answer: D

Taking stability as the factor, which one of the following represents correct relationship?

(1)

AlCl > AlCl₃

(2)

TlI > TlI₃

(3)

TlCl₃ > TlCl

(4)

InI₃ > InI

Show answer & solution
Answer: B

Amongst the given options which of the following molecules/ion acts as a Lewis acid?

(1)

BF₃

(2)

OH⁻

(3)

NH₃

(4)

H₂O

Show answer & solution
Answer: A
74
The Solid State

A compound is formed by two elements A and B. The element B forms cubic close packed structure and atoms of A occupy 1/3 of tetrahedral voids. If the formula of the compound is AₓBᵧ, then the value of x + y is in option

(1)

3

(2)

2

(3)

5

(4)

4

Show answer & solution
Answer: C

Intermolecular forces are forces of attraction and repulsion between interacting particles that will include : A. dipole - dipole forces. B. dipole - induced dipole forces. C. hydrogen bonding. D. covalent bonding. E. dispersion forces. Choose the most appropriate answer from the options given below :

(1)

A, B, C, E are correct.

(2)

A, C, D, E are correct.

(3)

B, C, D, E are correct.

(4)

A, B, C, D are correct.

Show answer & solution
Answer: A

Match List - I with List - II : List - I A. Coke B. Diamond C. Fullerene D. Graphite List - II I. Carbon atoms are sp³ hybridised. II. Used as a dry lubricant III. Used as a reducing agent IV. Cage like molecules Choose the correct answer from the options given below :

(1)

A-III, B-I, C-IV, D-II

(2)

A-III, B-IV, C-I, D-II

(3)

A-II, B-IV, C-I, D-III

(4)

A-IV, B-I, C-II, D-III

Show answer & solution
Answer: A

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic. Reasons R : The deep blue solution is due to the formation of amide. In the light of the above statements, choose the correct answer from the options given below :

(1)

A is true but R is false.

(2)

A is false but R is true.

(3)

Both A and R are true and R is the correct explanation of A.

(4)

Both A and R are true but R is NOT the correct explanation of A.

Show answer & solution
Answer: A

Which one is an example of heterogenous catalysis?

(1)

Decomposition of ozone in presence of nitrogen monoxide.

(2)

Combination between dinitrogen and dihydrogen to form ammonia in the presence of finely divided iron.

(3)

Oxidation of sulphur dioxide into sulphur trioxide in the presence of oxides of nitrogen.

(4)

Hydrolysis of sugar catalysed by H⁺ ions.

Show answer & solution
Answer: B

Amongst the following, the total number of species NOT having eight electrons around central atom in its outer most shell, is NH₃, AlCl₃, BeCl₂, CCl₄, PCl₅ :

(1)

4

(2)

1

(3)

3

(4)

2

Show answer & solution
Answer: C

The stability of Cu²⁺ is more than Cu⁺ salts in aqueous solution due to -

(1)

hydration energy.

(2)

second ionisation enthalpy.

(3)

first ionisation enthalpy.

(4)

enthalpy of atomization.

Show answer & solution
Answer: A

The relation between nₘ, (nₘ = the number of permissible values of magnetic quantum number (m)) for a given value of azimuthal quantum number (l), is

(1)

nₘ = 2l² + 1

(2)

nₘ = l + 2

(3)

l = (nₘ - 1)/2

(4)

l = 2nₘ + 1

Show answer & solution
Answer: C

The right option for the mass of CO₂ produced by heating 20 g of 20% pure limestone is (Atomic mass of Ca = 40) [CaCO₃ →(1200 K) CaO + CO₂]

(1)

64 g

(2)

32 g

(3)

12 g

(4)

76 g

Show answer & solution
Answer: D

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: In equation ΔᵣG = −nFE_cell, value of ΔᵣG depends on n. Reasons R: E_cell is an intensive property and ΔᵣG is an extensive property. In the light of the above statements, choose the correct answer from the options given below:

(1)

A is true but R is false.

(2)

A is false but R is true.

(3)

Both A and R are true and R is the correct explanation of A.

(4)

Both A and R are true and R is NOT the correct explanation of A.

Show answer & solution
Answer: C

For a certain reaction, the rate = k[A]²[B], when the initial concentration of A is tripled keeping concentration of B constant, the initial rate would

(1)

increase by a factor of nine.

(2)

increase by a factor of three.

(3)

decrease by a factor of nine.

(4)

increase by a factor of six.

Show answer & solution
Answer: A

Weight (g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with sodium hydroxide in presence of calcium oxide is:

(1)

30

(2)

18

(3)

16

(4)

32

Show answer & solution
Answer: D

Which of the following statements are INCORRECT? A. All the transition metals except scandium form MO oxides which are ionic. B. The highest oxidation number corresponding to the group number in transition metal oxides is attained in Sc₂O₃ to Mn₂O₇. C. Basic character increases from V₂O₃ to V₂O₄ to V₂O₅. D. V₂O₄ dissolves in acids to give VO₃⁻ salts. E. CrO is basic but Cr₂O₃ is amphoteric. Choose the correct answer from the options given below :

(1)

C and D only

(2)

B and C only

(3)

A and E only

(4)

B and D only

Show answer & solution
Answer: A
87
None of the provided chapters directly address the thermodynamic relationship between change in enthalpy and change in internal energy. However, the closest relevant chapter in the context of plant biology and energy processes might be: Photosynthesis in Higher Plants

Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?

(1)

ΔH - ΔU = - ΔnRT

(2)

ΔH + ΔU = ΔnR

(3)

ΔH = ΔU - Δn_gRT

(4)

ΔH = ΔU + Δn_gRT

Show answer & solution
Answer: D

What fraction of one edge centred octahedral void lies in one unit cell of fcc?

(1)

1/4

(2)

1/12

(3)

1/2

(4)

1/3

Show answer & solution
Answer: A
89
Environmental Issues

Given below are two statements : Statement I : The nutrient deficient water bodies lead to eutrophication. Statement II : Eutrophication leads to decrease in the level of oxygen in the water bodies. In the light of the above statements, choose the correct answer from the options given below :

(1)

Statement I is correct but Statement II is false.

(2)

Statement I is incorrect but Statement II is true.

(3)

Both Statement I and Statement II are true.

(4)

Both Statement I and Statement II are false.

Show answer & solution
Answer: B
90
Organic Chemistry is not in the list. The question seems to be more related to chemistry than botany. However, from the given list, no chapter directly matches the topic of organic chemistry or dehydration reactions. If I must choose the closest related chapter, it would be: Cell: The Unit of

Which amongst the following will be most readily dehydrated under acidic conditions?

(1)

Structure with NO₂, H, OH, and OH groups on adjacent carbons

(2)

Structure with NO₂ and OH groups on adjacent carbons in a chain

(3)

Structure with NO₂, OH, and CH₃ groups on adjacent carbons

(4)

Structure with two OH groups and a CH₃ group on adjacent carbons

Show answer & solution
Answer: D
91
None of the provided chapters directly address the stability of complex compounds, which is more related to coordination chemistry in the field of Inorganic Chemistry. However, since the question must be answered with a chapter from the provided list, and given the context of Botany, no chapter is a perfect match. If

Which complex compound is most stable?

(1)

[CoCl₂(en)₂]NO₃

(2)

[Co(NH₃)₆]₂(SO₄)₃

(3)

[Co(NH₃)₄(H₂O)Br](NO₃)₂

(4)

[Co(NH₃)₃(NO₃)₃]

Show answer & solution
Answer: A
92
Environmental Issues

Match List - I with List - II : List - I (Oxoacids of Sulphur) A. Peroxodisulphuric acid B. Sulphuric acid C. Pyrosulphuric acid D. Sulphurous acid List - II (Bonds) I. Two S-OH, Four S=O, One S-O-S II. Two S-OH, One S=O III. Two S-OH, Four S=O, One S-O-O-S IV. Two S-OH, Two S=O

(1)

A-I, B-III, C-IV, D-II

(2)

A-III, B-IV, C-II, D-I

(3)

A-I, B-III, C-II, D-IV

(4)

A-III, B-IV, C-I, D-II

Show answer & solution
Answer: D

Identify the major product obtained in the following reaction : [Chemical structure of o-phthalaldehyde] + 2[Ag(NH₃)₂]⁺ + 3⁻OH → major product

(1)

OH group on benzene ring with CH₂OH at ortho position

(2)

Carbonyl group on benzene ring with CH₂OH at ortho position

(3)

OH group on benzene ring with COO⁻ at ortho position

(4)

Carbonyl group on benzene ring with COO⁻ at ortho position

Show answer & solution
Answer: D
94
General Principles and Processes of Isolation of Elements

The reaction that does NOT take place in a blast furnace between 900 K to 1500 K temperature range during extraction of iron is :

(1)

C + CO₂ → 2CO

(2)

CaO + SiO₂ → CaSiO₃

(3)

Fe₂O₃ + CO → 2FeO + CO₂

(4)

FeO + CO → Fe + CO₂

Show answer & solution
Answer: C
95
None of the provided chapters are relevant to the given question. The question pertains to chemical equilibrium and Gibbs free energy, which are topics typically covered in Chemistry, not Botany. However, since the task requires selecting a chapter from the provided list, and none are directly applicable, no chapter can be

The equilibrium concentrations of the species in the reaction A + B ⇌ C + D are 2, 3, 10 and 6 mol L⁻¹, respectively at 300 K. ΔG° for the reaction is (R = 2 cal / mol K)

(1)

−1381.80 cal

(2)

−13.73 cal

(3)

1372.60 cal

(4)

−137.26 cal

Show answer & solution
Answer: A

Pumice stone is an example of -

(1)

solid sol

(2)

foam

(3)

sol

(4)

gel

Show answer & solution
Answer: A

Consider the following compounds/species: i. [naphthalene structure] ii. [cyclopentadienyl anion structure] iii. [cyclobutadiene structure] iv. [cyclopropenyl anion structure] v. [cyclopropenyl cation structure] vi. [cyclooctatetraene structure] vii. [anthracene structure] The number of compounds/species which obey Huckel’s rule is ______.

(1)

2

(2)

5

(3)

4

(4)

6

Show answer & solution
Answer: C
98
None of the provided chapters in the list are relevant to the redox reaction question. However, following the instruction to return only the most relevant chapter name from the provided list, I must select one. Since the question is not botany-related, no chapter fits, but I will provide a default as

On balancing the given redox reaction, a Cr₂O₇²⁻ + b SO₃²⁻(aq) + c H⁺(aq) → 2a Cr³⁺(aq) + b SO₄²⁻(aq) + c/2 H₂O(ℓ) the coefficients a, b and c are found to be, respectively -

(1)

1, 8, 3

(2)

8, 1, 3

(3)

1, 3, 8

(4)

3, 8, 1

Show answer & solution
Answer: C

Consider the following reaction : [Chemical structure of diphenyl ether] →[HI, Δ] A + B Identify products A and B.

(1)

A = benzyl iodide and B = phenol

(2)

A = toluene and B = iodobenzene

(3)

A = toluene and B = phenol

(4)

A = benzyl alcohol and B = iodobenzene

Show answer & solution
Answer: A
100
Organic Chemistry is not in the provided list. However, based on the given chapters, the closest match is: Cell: The Unit of Life Note: The question provided is more related to Organic Chemistry, which is not listed in the provided Botany chapters. The answer given is the closest match

Identify the final product [D] obtained in the following sequence of reactions. CH₃CHO →[i) LiAlH₄, ii) H₃O⁺] [A] →[H₂SO₄, Δ] [B] →[HBr] [C] →[bromobenzene, Na/dry ether] [D]

(1)

C₄H₁₀

(2)

HC≡C⁻ Na⁺

(3)

[ethylbenzene structure]

(4)

[biphenyl structure]

Show answer & solution
Answer: C

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Late wood has fewer xylary elements with narrow vessels. Reason R : Cambium is less active in winters. In the light of the above statements, choose the correct answer from the options given below :

(1)

A is true but R is false.

(2)

A is false but R is true.

(3)

Both A and R are true and R is the correct explanation of A.

(4)

Both A and R are true but R is NOT the correct explanation of A.

Show answer & solution
Answer: C

The phenomenon of pleiotropism refers to

(1)

a single gene affecting multiple phenotypic expression.

(2)

more than two genes affecting a single character.

(3)

presence of several alleles of a single gene controlling a single crossover.

(4)

presence of two alleles, each of the two genes controlling a single trait.

Show answer & solution
Answer: A
103
Environmental Issues

The thickness of ozone in a column of air in the atmosphere is measured in terms of :

(1)

Decameter

(2)

Kilobase

(3)

Dobson units

(4)

Decibels

Show answer & solution
Answer: C

In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :

(1)

Synergids, Zygote and Primary endosperm nucleus

(2)

Synergids, antipodals and Polar nuclei

(3)

Synergids, Primary endosperm nucleus and zygote

(4)

Antipodals, synergids, and primary endosperm nucleus

Show answer & solution
Answer: A
105
Transport in Plants

Given below are two statements : Statement I : The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height. Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporative cooling. In the light of the above statements, choose the most appropriate answer from the options given below :

(1)

Statement I is correct but Statement II is incorrect.

(2)

Statement I is incorrect but Statement II is correct.

(3)

Both Statement I and Statement II are correct.

(4)

Both Statement I and Statement II are incorrect.

Show answer & solution
Answer: C

Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by

(1)

Alfred Sturtevant

(2)

Henking

(3)

Thomas Hunt Morgan

(4)

Sutton and Boveri

Show answer & solution
Answer: A

In the equation GPP - R = NPP GPP is Gross Primary Productivity NPP is Net Primary Productivity R here is ____________.

(1)

Respiratory loss

(2)

Reproductive allocation

(3)

Photosynthetically active radiation

(4)

Respiratory quotient

Show answer & solution
Answer: A

Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species?

(1)

Alien species invasions

(2)

Co-extinctions

(3)

Habitat loss and fragmentation

(4)

Over exploitation for economic gain

Show answer & solution
Answer: C

How many ATP and NADPH₂ are required for the synthesis of one molecule of Glucose during Calvin cycle?

(1)

12 ATP and 16 NADPH₂

(2)

18 ATP and 16 NADPH₂

(3)

12 ATP and 12 NADPH₂

(4)

18 ATP and 12 NADPH₂

Show answer & solution
Answer: D

Given below are two statements : Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body. Statement II : Exarch condition is the most common feature of the root system. In the light of the above statements, choose the correct answer from the options given below :

(1)

Statement I is correct but Statement II is false.

(2)

Statement I is incorrect but Statement II is true.

(3)

Both Statement I and Statement II are true.

(4)

Both Statement I and Statement II are false.

Show answer & solution
Answer: B

Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.

(1)

Monoadelphous and Monothecous anthers

(2)

Epiphyllous and Dithecous anthers

(3)

Diadelphous and Dithecous anthers

(4)

Polyadelphous and epipetalous stamens

Show answer & solution
Answer: C

Identify the pair of heterosporous pteridophytes among the following :

(1)

Psilotum and Salvinia

(2)

Equisetum and Salvinia

(3)

Lycopodium and Selaginella

(4)

Selaginella and Salvinia

Show answer & solution
Answer: D

Among eukaryotes, replication of DNA takes place in -

(1)

G₂ phase

(2)

G₁ phase

(3)

M phase

(4)

S phase

Show answer & solution
Answer: D

Which hormone promotes internode/petiole elongation in deep water rice?

(1)

Ethylene

(2)

2, 4-D

(3)

GA₃

(4)

Kinetin

Show answer & solution
Answer: A

Large, colourful, fragrant flowers with nectar are seen in :

(1)

bat pollinated plants

(2)

wind pollinated plants

(3)

insect pollinated plants

(4)

bird pollinated plants

Show answer & solution
Answer: C

Which micronutrient is required for splitting of water molecule during photosynthesis?

(1)

magnesium

(2)

copper

(3)

manganese

(4)

molybdenum

Show answer & solution
Answer: C

Upon exposure to UV radiation, DNA stained with ethidium bromide will show

(1)

Bright yellow colour

(2)

Bright orange colour

(3)

Bright red colour

(4)

Bright blue colour

Show answer & solution
Answer: B

What is the function of tassels in the corn cob?

(1)

To disperse pollen grains

(2)

To protect seeds

(3)

To attract insects

(4)

To trap pollen grains

Show answer & solution
Answer: D

During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out

(1)

Histones

(2)

Polysaccharides

(3)

RNA

(4)

DNA

Show answer & solution
Answer: D

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : ATP is used at two steps in glycolysis. Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate. In the light of the above statements, choose the correct answer from the options given below :

(1)

A is true but R is false.

(2)

A is false but R is true.

(3)

Both A and R are true and R is the correct explanation of A.

(4)

Both A and R are true but R is NOT the correct explanation of A.

Show answer & solution
Answer: C

Expressed Sequence Tags (ESTs) refers to

(1)

All genes whether expressed or unexpressed.

(2)

Certain important expressed genes.

(3)

All genes that are expressed as RNA.

(4)

All genes that are expressed as proteins.

Show answer & solution
Answer: C

Movement and accumulation of ions across a membrane against their concentration gradient can be explained by

(1)

Passive Transport

(2)

Active Transport

(3)

Osmosis

(4)

Facilitated Diffusion

Show answer & solution
Answer: B

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage. Reason R : Protonema develops directly from spores produced in capsule. In the light of the above statements, choose the most appropriate answer from the options given below :

(1)

A is correct but R is not correct.

(2)

A is not correct but R is correct.

(3)

Both A and R are correct and R is the correct explanation of A.

(4)

Both A and R are correct but R is NOT the correct explanation of A.

Show answer & solution
Answer: C

Identify the correct statements : A. Detrivores perform fragmentation. B. The humus is further degraded by some microbes during mineralization. C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching. D. The detritus food chain begins with living organisms. E. Earthworms break down detritus into smaller particles by a process called catabolism. Choose the correct answer from the options given below :

(1)

C, D, E only

(2)

D, E, A only

(3)

A, B, C only

(4)

B, C, D only

Show answer & solution
Answer: C

The reaction centre in PS II has an absorption maxima at

(1)

660 nm

(2)

780 nm

(3)

680 nm

(4)

700 nm

Show answer & solution
Answer: C

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

(1)

Transcription of precursor of mRNA

(2)

Transcription of only snRNAs

(3)

Transcription of rRNAs (28S, 18S and 5.8S)

(4)

Transcription of tRNA, 5 srRNA and snRNA

Show answer & solution
Answer: D

Which of the following stages of meiosis involves division of centromere?

(1)

Anaphase II

(2)

Telophase

(3)

Metaphase I

(4)

Metaphase II

Show answer & solution
Answer: A

Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?

(1)

Zeatin

(2)

Abscisic Acid

(3)

Indole-3-butyric Acid

(4)

Gibberellic Acid

Show answer & solution
Answer: D

Cellulose does not form blue colour with Iodine because

(1)

It does not contain complex helices and hence cannot hold iodine molecules.

(2)

It breakes down when iodine reacts with it.

(3)

It is a disaccharide.

(4)

It is a helical molecule.

Show answer & solution
Answer: A

In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as -

(1)

Development

(2)

Senescence

(3)

Differentiation

(4)

Dedifferentiation

Show answer & solution
Answer: D

Axile placentation is observed in

(1)

Tomato, Dianthus and Pea

(2)

China rose, Petunia and Lemon

(3)

Mustard, Cucumber and Primrose

(4)

China rose, Beans and Lupin

Show answer & solution
Answer: B

Unequivocal proof that DNA is the genetic material was first proposed by

(1)

Avery, Macleoid and McCarthy

(2)

Wilkins and Franklin

(3)

Frederick Griffith

(4)

Alfred Hershey and Martha Chase

Show answer & solution
Answer: D

In gene gun method used to introduce alien DNA into host cells, microparticles of metal are used.

(1)

Tungsten or gold

(2)

Silver

(3)

Copper

(4)

Zinc

Show answer & solution
Answer: A

The historic Convention on Biological Diversity, ‘The Earth Summit’ was held in Rio de Janeiro in the year :

(1)

1986

(2)

2002

(3)

1985

(4)

1992

Show answer & solution
Answer: D

The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?

(1)

Diplotene

(2)

Diakinesis

(3)

Zygotene

(4)

Pachytene

Show answer & solution
Answer: D

Match List I with List II : List I List II A. Iron I. Synthesis of auxin B. Zinc II. Component of nitrate reductase C. Boron III. Activator of catalase D. Molybdenum IV. Cell elongation and differentiation

(1)

A-III, B-I, C-IV, D-II

(2)

A-II, B-IV, C-I, D-III

(3)

A-III, B-II, C-I, D-IV

(4)

A-II, B-III, C-IV, D-I

Show answer & solution
Answer: A
137
None of the provided chapters directly match the topic of Recombinant DNA formation. However, the closest relevant chapter based on the subject of Zoology and the given list is Human Health and Disease as it may cover some aspects of genetic engineering and biotechnology in the context of human health. However, it

Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence. A. Insertion of recombinant DNA into the host cell. B. Cutting of DNA at specific location by restriction enzyme. C. Isolation of desired DNA fragment. D. Amplification of gene of interest using PCR.

(1)

C, B, D, A

(2)

B, D, A, C

(3)

B, C, D, A

(4)

C, A, B, D

Show answer & solution
Answer: B

Which one of the following statements is NOT correct?

(1)

Water hyacinth grows abundantly in eutrophic water bodies and leads to an imbalance in the ecosystem dynamics of the water body.

(2)

The amount of some toxic substances of industrial waste water increases in the organisms at successive trophic levels.

(3)

The micro-organisms involved in biodegradation of organic matter in a sewage polluted water body consume a lot of oxygen causing the death of aquatic organisms.

(4)

Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries.

Show answer & solution
Answer: D

How many different proteins does the ribosome consist of?

(1)

40

(2)

20

(3)

80

(4)

60

Show answer & solution
Answer: C

Match List I with List II : List I A. Cohesion B. Adhesion C. Surface tension D. Guttaion List II I. More attraction in liquid phase II. Mutual attraction among water molecules III. Water loss in liquid phase IV. Attraction towards polar surfaces Choose the correct answer from the options given below :

(1)

A-III, B-I, C-IV, D-II

(2)

A-II, B-I, C-IV, D-III

(3)

A-II, B-IV, C-I, D-III

(4)

A-IV, B-III, C-II, D-I

Show answer & solution
Answer: C

Which of the following combinations is required for chemiosmosis?

(1)

proton pump, electron gradient, ATP synthase

(2)

proton pump, electron gradient, NADP synthase

(3)

membrane, proton pump, proton gradient, ATP synthase

(4)

membrane, proton pump, proton gradient, NADP synthase

Show answer & solution
Answer: C
142
None of the provided chapters directly match the content of the question, which is about cell cycle phases. However, the closest relevant chapter in the provided list is "Reproduction in Organisms" as it may cover aspects of cell division. But since the question is specifically about the cell cycle phases, it

Match List I with List II : List I A. M Phase B. G₂ Phase C. Quiescent stage D. G₁ Phase List II I. Proteins are synthesized II. Inactive phase III. Interval between mitosis and initiation of DNA replication IV. Equational division Choose the correct answer from the options given below :

(1)

A-II, B-IV, C-I, D-III

(2)

A-III, B-II, C-IV, D-I

(3)

A-IV, B-II, C-I, D-III

(4)

A-IV, B-I, C-II, D-III

Show answer & solution
Answer: D

Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of

(1)

Lipase

(2)

Dinitrogenase

(3)

Succinic dehydrogenase

(4)

Amylase

Show answer & solution
Answer: C

Which of the following statements are correct about Klinefelter’s Syndrome? A. This disorder was first described by Langdon Down (1866). B. Such an individual has overall masculine development. However, the feminine development is also expressed. C. The affected individual is short statured. D. Physical, psychomotor and mental development is retarded. E. Such individuals are sterile. Choose the correct answer from the options given below :

(1)

B and E only

(2)

A and E only

(3)

A and B only

(4)

C and D only

Show answer & solution
Answer: A

Match List I with List II.

List-IList-II
A. P-waveI. Beginning of systole
B. Q-waveII. Repolarisation of ventricles
C. QRS complexIII. Depolarisation of atria
D. T-waveIV. Depolarisation of ventricles

Choose the correct answer from the options given below:

(1)

A-I, B-II, C-III, D-IV

(2)

A-II, B-IV, C-I, D-III

(3)

A-III, B-I, C-IV, D-II

(4)

A-IV, B-III, C-II, D-I

Show answer & solution
Answer: C

Match List I with List II : List I List II A. Oxidative decarboxylation I. Citrate synthase B. Glycolysis II. Pyruvate dehydrogenase C. Oxidative phosphorylation III. Electron transport system D. Tricarboxylic acid cycle IV. EMP pathway

(1)

A-III, B-I, C-II, D-IV

(2)

A-II, B-IV, C-III, D-I

(3)

A-III, B-IV, C-II, D-I

(4)

A-II, B-IV, C-I, D-III

Show answer & solution
Answer: B
147
Reproduction in Organisms

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air currents. Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed. In the light of the above statements, choose the correct answer from the options given below :

(1)

A is true but R is false.

(2)

A is false but R is true.

(3)

Both A and R are true and R is the correct explanation of A.

(4)

Both A and R are true but R is NOT the correct explanation of A.

Show answer & solution
Answer: A

Given below are two statements : Statement I : Gause’s ‘Competitive Exclusion Principle’ states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually. Statement II : In general, carnivores are more adversely affected by competition than herbivores. In the light of the above statements, choose the correct answer from the options given below :

(1)

Statement I is correct but Statement II is false.

(2)

Statement I is incorrect but Statement II is true.

(3)

Both Statement I and Statement II are true.

(4)

Both Statement I and Statement II are false.

Show answer & solution
Answer: A

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem. Reason R : Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves. In the light of the above statements, choose the correct answer from the options given below :

(1)

A is true but R is false.

(2)

A is false but R is true.

(3)

Both A and R are true and R is the correct explanation of A.

(4)

Both A and R are true but R is NOT the correct explanation of A.

Show answer & solution
Answer: C

Identify the correct statements : A. Lenticels are the lens-shaped openings permitting the exchange of gases. B. Bark formed early in the season is called hard bark. C. Bark is a technical term that refers to all tissues exterior to vascular cambium. D. Bark refers to periderm and secondary phloem. E. Phellogen is single-layered in thickness.

(1)

A, B and D only

(2)

B and C only

(3)

B, C and E only

(4)

A and D only

Show answer & solution
Answer: D

In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?

(1)

Basophils

(2)

Eosinophils

(3)

Tₕ cells

(4)

B-lymphocytes

Show answer & solution
Answer: C

Match List I with List II. List I List II A. Gene ‘a’ I. β-galactosidase B. Gene ‘y’ II. Transacetylase C. Gene ‘i’ III. Permease D. Gene ‘z’ IV. Repressor protein Choose the correct answer from the options given below:

(1)

A-III, B-IV, C-I, D-II

(2)

A-III, B-I, C-IV, D-II

(3)

A-II, B-I, C-IV, D-III

(4)

A-II, B-III, C-IV, D-I

Show answer & solution
Answer: D

Match List I with List II. List I: A. Ringworm, B. Filariasis, C. Malaria, D. Pneumonia. List II: I. Haemophilus influenzae, II. Trichophyton, III. Wuchereria bancrofti, IV. Plasmodium vivax. Choose the correct answer from the options given below:

(1)

A-III, B-II, C-I, D-IV

(2)

A-III, B-II, C-IV, D-I

(3)

A-II, B-III, C-IV, D-I

(4)

A-II, B-III, C-I, D-IV

Show answer & solution
Answer: C

Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.

(1)

Mole, Flying squirrel, Tasmanian tiger cat

(2)

Lemur, Anteater, Wolf

(3)

Tasmanian wolf, Bobcat, Marsupial mole

(4)

Numbat, Spotted cuscus, Flying phalanger

Show answer & solution
Answer: D

Given below are statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla. Reason R: Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle. In the light of the above statements, choose the correct answer from the options given below:

(1)

A is true but R is false.

(2)

A is false but R is true.

(3)

Both A and R are true and R is the correct explanation of A.

(4)

Both A and R are true but R is NOT the correct explanation of A.

Show answer & solution
Answer: A

Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below:

(1)

Statement I is correct but Statement II is false.

(2)

Statement I incorrect but Statement II is true.

(3)

Both Statement I and Statement II are true.

(4)

Both Statement I and Statement II are false.

Show answer & solution
Answer: B

Which of the following statements are correct regarding female reproductive cycle? A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle. B. First menstrual cycle begins at puberty and is called menopause. C. Lack of menstruation may be indicative of pregnancy. D. Cyclic menstruation extends between menarche and menopause. Choose the most appropriate answer from the options given below:

(1)

A, B and C only

(2)

A, C and D only

(3)

A and D only

(4)

A and B only

Show answer & solution
Answer: B

Given below are two statements: Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct. Statement II: The cavity of the cervix is called cervical canal which along with vagina forms birth canal. In the light of the above statements, choose the correct answer from the options given below:

(1)

Statement I is correct but Statement II is false.

(2)

Statement I incorrect but Statement II is true.

(3)

Both Statement I and Statement II are true.

(4)

Both Statement I and Statement II are false.

Show answer & solution
Answer: C

Given below are two statements: Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat. Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor. In the light of the above statements, choose the correct answer from the options given below:

(1)

Statement I is true but Statement II is false.

(2)

Statement I is false but Statement II is true.

(3)

Both Statement I and Statement II are true.

(4)

Both Statement I and Statement II are false.

Show answer & solution
Answer: C

Match List I with List II.

List-IList-II
A. HeroinI. Effect on cardiovascular system
B. MarijuanaII. Slow down body function
C. CocaineIII. Painkiller
D. MorphineIV. Interfere with transport of dopamine

Choose the correct answer from the options given below:

(1)

A-IV, B-III, C-II, D-I

(2)

A-III, B-IV, C-I, D-II

(3)

A-II, B-I, C-IV, D-III

(4)

A-I, B-II, C-III, D-IV

Show answer & solution
Answer: C

Match List I with List II.

List-IList-II
A. Mast cellsI. Ciliated epithelium
B. Inner surface of bronchioleII. Areolar connective tissue
C. BloodIII. Cuboidal epithelium
D. Tubular parts of nephronIV. specialised connective tissue

Choose the correct answer from the options give below:

(1)

A-I, B-II, C-IV, D-III

(2)

A-II, B-I, C-IV, D-III

(3)

A-III, B-IV, C-II, D-I

(4)

A-II, B-III, C-I, D-IV

Show answer & solution
Answer: B

Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?

(1)

Polymerase Chain Reaction (PCR) technique

(2)

Enzyme Linked Immuno-Sorbent Assay (ELISA) technique

(3)

Recombinant DNA Technology

(4)

Serum and Urine analysis

Show answer & solution
Answer: D

Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. In the light of the above statements, choose the correct answer from the options given below:

(1)

Statement I is true but Statement II is false.

(2)

Statement I false but Statement II is true.

(3)

Both Statement I and Statement II are true.

(4)

Both Statement I and Statement II are false.

Show answer & solution
Answer: C

Radial symmetry is NOT found in adults of phylum ________.

(1)

Coelenterata

(2)

Echinodermata

(3)

Ctenophora

(4)

Hemichordata

Show answer & solution
Answer: D

Broad palm with single palm crease is visible in a person suffering from-

(1)

Klinefelter’s syndrome

(2)

Thalassemia

(3)

Down’s syndrome

(4)

Turner’s syndrome

Show answer & solution
Answer: C

Match List I with List II. List I (Type of Joint) List II (Found between) A. Cartilaginous Joint I. Between flat skull bones B. Ball and Socket Joint II. Between adjacent vertebrae in vertebral column C. Fibrous Joint III. Between carpal and metacarpal of thumb D. Saddle Joint IV. Between Humerus and Pectoral girdle Choose the correct answer from the options given below:

(1)

A-I, B-IV, C-III, D-II

(2)

A-II, B-IV, C-III, D-I

(3)

A-III, B-I, C-II, D-IV

(4)

A-II, B-IV, C-I, D-III

Show answer & solution
Answer: D

Match List I with List II. List I List II A. CCK I. Kidney B. GIP II. Heart C. ANF III. Gastric gland D. ADH IV. Pancreas Choose the correct answer from the options given below:

(1)

A-II, B-IV, C-I, D-III

(2)

A-IV, B-II, C-III, D-I

(3)

A-IV, B-III, C-II, D-I

(4)

A-III, B-II, C-IV, D-I

Show answer & solution
Answer: C

Given below are two statements: Statement I: Electrostatic precipitator is most widely used in thermal power plant. Statement II: Electrostatic precipitator in thermal power plant removes ionising radiations In the light of the above statements, choose the most appropriate answer from the options given below:

(1)

Statement I is correct but Statement II is incorrect.

(2)

Statement I incorrect but Statement II is correct.

(3)

Both Statement I and Statement II are correct.

(4)

Both Statement I and Statement II are incorrect.

Show answer & solution
Answer: A

Match List I with List II.

Interacting speciesName of Interaction
A. A Leopard and a Lion in a forest/grasslandI. Competition
B. A Cuckoo laying egg in a Crow’s nestII. Brood parasitism
C. Fungi and root of a higher plant in MycorrtizaeIII. Mutualism
D. A cattle egret and a Cattle in a fieldIV. Commensalism

Choose the correct answer from the options given below:

(1)

A-III, B-IV, C-I, D-II

(2)

A-II, B-III, C-I, D-IV

(3)

A-I, B-II, C-III, D-IV

(4)

A-I, B-II, C-IV, D-III

Show answer & solution
Answer: C

Given below are two statements: Statement I: Ligaments are dense irregular tissue. Statement II: Cartilage is dense regular tissue. In the light of the above statements, choose the correct answer from the options given below:

(1)

Statement I is true but Statement II is false.

(2)

Statement I is false but Statement II is true.

(3)

Both Statement I and Statement II are true.

(4)

Both Statement I and Statement II are false.

Show answer & solution
Answer: D

Which of the following statements is correct?

(1)

Presence of large amount of nutrients in water restricts ‘Algal Bloom’

(2)

Algal Bloom decreases fish mortality

(3)

Eutrophication refers to increase in domestic sewage and waste water in lakes.

(4)

Biomagnification refers to increase in concentration of the toxicant at successive trophic levels.

Show answer & solution
Answer: D

Which one of the following symbols represents mating between relatives in human pedigree analysis?

(1)

■ ● ◆

(2)

□—○

(3)

□=○

(4)

□—○ | ■

Show answer & solution
Answer: C
173
Reproduction in Organisms

Which of the following is not a cloning vector?

(1)

pBR322

(2)

Probe

(3)

BAC

(4)

YAC

Show answer & solution
Answer: B

Given below are two statements: Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal) Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of α type and two subunits of β type.) In the light of the above statements, choose the correct answer from the options given below:

(1)

Statement I is true but Statement II is false.

(2)

Statement I is false but Statement II is true.

(3)

Both Statement I and Statement II are true.

(4)

Both Statement I and Statement II are false.

Show answer & solution
Answer: B

Which of the following functions is carried out by cytoskeleton in a cell?

(1)

Motility

(2)

Transportation

(3)

Nuclear division

(4)

Protein synthesis

Show answer & solution
Answer: A

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Endometrium is necessary for implantation of blastocyst. Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium. In the light of the above statements, choose the correct answer from the options given below:

(1)

A is true but R is false.

(2)

A is false but R is true.

(3)

Both A and R are true and R is the correct explanation of A.

(4)

Both A and R are true but R is NOT the correct explanation of A.

Show answer & solution
Answer: D

Match List I with List II. List I List II A. Taenia I. Nephridia B. Paramoecium II. Contractile vacuole C. Periplaneta III. Flame cells D. Pheretima IV. Ureose gland Choose the correct answer from the options give below:

(1)

A-III, B-II, C-IV, D-I

(2)

A-II, B-I, C-IV, D-III

(3)

A-I, B-II, C-III, D-IV

(4)

A-I, B-II, C-IV, D-III

Show answer & solution
Answer: A

Which of the following are NOT considered as the part of endomembrane system? A. Mitochondria B. Endoplasmic Reticulum C. Chloroplasts D. Golgi complex E. Peroxisomes Choose the most appropriate answer from the options given below:

(1)

A and D only

(2)

A, D and E only

(3)

B and D only

(4)

A, C and E only

Show answer & solution
Answer: D

Match List I with List II. List I List II A. Vasectomy I. Oral method B. Coitus II. Barrier method interruptus C. Cervical caps III. Surgical method D. Saheli IV. Natural method Choose the correct answer from the options given below:

(1)

A-II, B-III, C-I, D-IV

(2)

A-IV, B-II, C-I, D-III

(3)

A-III, B-I, C-IV, D-II

(4)

A-III, B-IV, C-II, D-I

Show answer & solution
Answer: D

Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by-

(1)

Gastro - oesophageal sphincter

(2)

Pyloric sphincter

(3)

Sphincter of Oddi

(4)

Ileo - caecal valve

Show answer & solution
Answer: D

Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?

(1)

Hepatitis-B

(2)

HIV Infection

(3)

Genital herpes

(4)

Gonorrhoea

Show answer & solution
Answer: D

Vital capacity of lung is _______.

(1)

IRV + ERV + TV + RV

(2)

IRV + ERV + TV

(3)

IRV + ERV

(4)

IRV + ERV + TV – RV

Show answer & solution
Answer: B

Match List I with List II with respect to human eye. List I A. Fovea B. Iris C. Blind spot D. Sclera List II I. Visible coloured portion of eye that regulates diameter of pupil. II. External layer of eye formed of dense connective tissue. III. Point of greatest visual acuity or resolution. IV. Point where optic nerve leaves the eyeball and photoreceptor cells are absent. Choose the correct answer from the options given below:

(1)

A-I, B-IV, C-III, D-II

(2)

A-II, B-I, C-III, D-IV

(3)

A-III, B-I, C-IV, D-II

(4)

A-IV, B-III, C-II, D-I

Show answer & solution
Answer: C

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme. Reason R: Ban on amniocentesis checks increasing menace of female foeticide. In the light of the above statements, choose the correct answer from the options given below:

(1)

A is true but R is false.

(2)

A is false but R is true.

(3)

Both A and R are true and R is the correct explanation of A.

(4)

Both A and R are true and R is NOT the correct explanation of A.

Show answer & solution
Answer: B

Which of the following statements are correct regarding skeletal muscle? A. Muscle bundles are held together by collagenous connective tissue layer called fascicle. B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions. C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins. D. M line is considered as functional unit of contraction called sarcomere. Choose the most appropriate answer from the options given below:

(1)

A, C and D only

(2)

C and D only

(3)

A, B and C only

(4)

B and C only

Show answer & solution
Answer: D

Which of the following are NOT under the control of thyroid hormone?

(1)

Regulation of basal metabolic rate

(2)

Development of immune system

(3)

Normal rhythm of sleep-wake cycle

(4)

Maintenance of water and electrolyte balance

Show answer & solution
Answer: B

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3’?

(1)

5’ ATCGATCGATCGATCGATCG ATCGATCG 3’

(2)

3’ ATCGATCGATCGATCGATCG ATCGATCG 5’

(3)

5’ UAGCUAGCUAGCUAGCUA GCUAGC UAGC 3’

(4)

3’ UAGCUAGCUAGCUAGCUA GCUAGCUAGC 5’

Show answer & solution
Answer: A

Select the correct statements with reference to chordates. A. Presence of a mid-dorsal, solid and double nerve cord. B. Presence of closed circulatory system. C. Presence of paired pharyngeal gillslits. D. Presence of dorsal heart E. Triploblastic pseudocoelomate animals. Choose the correct answer from the options given below:

(1)

B, D and E only

(2)

C, D and E only

(3)

A, C and D only

(4)

B and C only

Show answer & solution
Answer: D

The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are :

(1)

Brain stem & epithalamus

(2)

Corpus callosum and thalamus

(3)

Limbic system & hypothalamus

(4)

Corpora quadrigemina & hippocampus

Show answer & solution
Answer: C

Which of the following is characteristic feature of cockroach regarding sexual dimorphism ?

(1)

Presence of sclerites

(2)

Presence of anal cerci

(3)

Dark brown body colour and anal cerci

(4)

Presence of anal styles

Show answer & solution
Answer: D

Given below are two statements: Statement I: During G₀ phase of cell cycle, the cell is metabolically inactive. Statement II: The centrosome undergoes duplication during S phase of interphase. In the light of the above statements, choose the most appropriate answer from the options given below:

(1)

Statement I is correct but Statement II is incorrect.

(2)

Statement I is incorrect but Statement II is correct.

(3)

Both Statement I and Statement II are correct.

(4)

Both Statement I and Statement II are incorrect.

Show answer & solution
Answer: B

The unique mammalian characteristics are:

(1)

hairs, pinna and indirect development

(2)

pinna, monocondylic skull and mammary glands

(3)

hairs, tympanic membrane and mammary glands

(4)

hairs, pinna and mammary glands

Show answer & solution
Answer: D

Which of the following statements are correct ? A. Basophils are most abundant cells of the total WBCs B. Basophils secrete histamine, serotonin and heparin C. Basophils are involved in inflammatory response D. Basophils have kidney shaped nucleus E. Basophils are agranulocytes

(1)

B and C only

(2)

A and B only

(3)

D and E only

(4)

C and E only

Show answer & solution
Answer: A

Which of the following statements are correct? A. An excessive loss of body fluid from the body switches off osmoreceptors. B. ADH facilitates water reabsorption to prevent diuresis. C. ANF causes vasodilation. D. ADH causes increase in blood pressure. E. ADH is responsible for decrease in GFR.

(1)

A, B and E only

(2)

C, D and E only

(3)

A and B only

(4)

B, C and D only

Show answer & solution
Answer: D

Select the correct statements. A. Tetrad formation is seen during Leptotene. B. During Anaphase, the centromeres split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi complex and ER are reformed during Telophase. E. Crossing over takes place between sister chromatids of homologous chromosome.

(1)

A, C and E only

(2)

B and E only

(3)

A and C only

(4)

B and D only

Show answer & solution
Answer: D
198
Reproduction in Organisms

Match List I with List II.

List-IList-II
A. Logistic growthI. Unlimited resource availability condition
B. Exponential growthII. Limited resource availability condition
C. Expanding age pyramidIII. The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups
D. Stable age pyramidIV. The percent individuals of pre-reproductives and reproductive age group are same
(1)

A-II, B-IV, C-I, D-III

(2)

A-II, B-IV, C-III, D-I

(3)

A-II, B-I, C-III, D-IV

(4)

A-II, B-III, C-I, D-IV

Show answer & solution
Answer: C

Which one of the following is NOT an advantage of inbreeding?

(1)

Elimination of less desirable genes and accumulation of superior genes takes place due to it.

(2)

It decreases the productivity of inbred population, after continuous inbreeding.

(3)

It decreases homozygosity.

(4)

It exposes harmful recessive genes that are eliminated by selection.

Show answer & solution
Answer: B

Run NEET 2023 as a real exam.

Sign up free to take this paper as a 3h 20min timed mock with full question palette and live timer, get a chapter-wise score breakdown, and predict your NEET 2027 score from real PYQ accuracy.

Free 14-day trial · No credit card · Cancel anytime

Source: National Testing Agency (NTA), NEET-UG 2023 Question Paper, Code H4. Solutions written for educational use, NCERT-aligned. Verify your answers against the official NTA answer key.