Official NTA NEET-UG 2023 question paper, set H5. 197 questions across Physics, Chemistry, and Biology with worked solutions and the official answer key.
A bullet is fired from a gun at the speed of 280 m s⁻¹ in the direction 30° above the horizontal. The maximum height attained by the bullet is (g = 9.8 m s⁻², sin 30° = 0.5):
1000 m
3000 m
2800 m
2000 m
A vehicle travels half the distance with speed ϑ and the remaining distance with speed 2ϑ. Its average speed is:
4ϑ/3
3ϑ/4
ϑ/3
2ϑ/3
The venturi-meter works on :
The principle of parallel axes
The principle of perpendicular axes
Huygen’s principle
Bernoulli’s principle
If the galvanometer G does not show any deflection in the circuit shown, the value of R is given by : [Diagram: A circuit with a 10 V battery, a 400 Ω resistor, a resistor R, a galvanometer G, and a 2 V battery arranged in a bridge-like configuration.]
100 Ω
400 Ω
200 Ω
50 Ω
For Young’s double slit experiment, two statements are given below: Statement I: If screen is moved away from the plane of slits, angular separation of the fringes remains constant. Statement II: If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases. In the light of the above statements, choose the correct answer from the options given below:
Statement I is true but Statement II is false.
Statement I is false but Statement II is true.
Both Statement I and Statement II are true.
Both Statement I and Statement II are false.
In hydrogen spectrum, the shortest wavelength in the Balmer series is λ. The shortest wavelength in the Bracket series is :
9 λ
16 λ
2 λ
4 λ
A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?
Capacitor
Load resistance
A centre-tapped transformer
p-n junction diodes
The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly: (surface tension of soap solution = 0.03 N m⁻¹)
01×10⁻⁴ J
50.1×10⁻⁴ J
30.16×10⁻⁴ J
5.06×10⁻⁴ J
The ratio of radius of gyration of a solid sphere of mass M and radius R about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is :
2 : 5
5 : 2
3 : 5
5 : 3
A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is :
along north-east
along south-west
along eastward
along northward
The half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to (1/16)th of its initial value?
60 minutes
80 minutes
20 minutes
40 minutes
In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of 2.0×10¹⁰ Hz and amplitude 48 V m⁻¹. Then the amplitude of oscillating magnetic field is : (Speed of light in free space = 3 × 10⁸ m s⁻¹)
6×10⁻⁶ T
6×10⁻⁹ T
6×10⁻⁸ T
6×10⁻⁷ T
The magnetic energy stored in an inductor of inductance 4 μH carrying a current of 2 A is :
8 mJ
8 μJ
4 μJ
4 mJ
In a series LCR circuit, the inductance L is 10 mH, capacitance C is 1 μF and resistance R is 100 Ω. The frequency at which resonance occurs is :
59 rad/s
59 kHz
15.9 rad/s
15.9 kHz
Light travels a distance x in time t₁ in air and 10x in time t₂ in another denser medium. What is the critical angle for this medium?
sin⁻¹(t₁/10t₂)
sin⁻¹(10t₁/t₂)
sin⁻¹(t₂/t₁)
sin⁻¹(10t₂/t₁)
An ac source is connected to a capacitor C. Due to decrease in its operating frequency :
displacement current decreases.
capacitive reactance remains constant
capacitive reactance decreases.
displacement current increases.
If ∮_S E⃗ ⋅ dS⃗ = 0 over a surface, then :
all the charges must necessarily be inside the surface.
the electric field inside the surface is necessarily uniform.
the number of flux lines entering the surface must be equal to the number of flux lines leaving it.
the magnitude of electric field on the surface is constant.
The potential energy of a long spring when stretched by 2 cm is U. If the spring is stretched by 8 cm, potential energy stored in it will be :
8U
16U
2U
4U
The equivalent capacitance of the system shown in the following circuit is :
6 μF
9 μF
2 μF
3 μF
The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are :
Least count errors
Random errors
Instrumental errors
Personal errors
Given below are two statements: Statement I : Photovoltaic devices can convert optical radiation into electricity. Statement II : Zener diode is designed to operate under reverse bias in breakdown region. In the light of the above statements, choose the most appropriate answer from the options given below :
Statement I is correct but Statement II is incorrect.
Statement I is incorrect but Statement II is correct.
Both Statement I and Statement II are correct.
Both Statement I and Statement II are incorrect.
The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is :
1 : 3
3 : 1
1 : 2
2 : 1
The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of V volts is proportional to:
1/V
V²
√V
1/√V
The work functions of Caesium (Cs), Potassium (K) and Sodium (Na) are 2.14 eV, 2.30 eV and 2.75 eV respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV, which of these photosensitive surfaces may emit photoelectrons?
K only
Na only
Cs only
Both Na and K
A Carnot engine has an efficiency of 50% when its source is at a temperature 327° C. The temperature of the sink is :
100° C
200° C
27° C
15° C
The net magnetic flux through any closed surface is :
Infinity
Negative
Zero
Positive
An electric dipole is placed at an angle of 30° with an electric field of intensity 2×10⁵ N C⁻¹. It experiences a torque equal to 4 N m. Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm.
4 mC
2 mC
8 mC
6 mC
Resistance of a carbon resistor determined from colour codes is (2200 ± 5%) Ω. The colour of third band must be :
Orange
Yellow
Red
Green
A metal wire has mass (0.4 ± 0.002) g, radius (0.3 ± 0.001) mm and length (5 ± 0.02) cm. The maximum possible percentage error in the measurement of density will nearly be:
6%
4%
2%
3%
The magnitude and direction of the current in the following circuit is
5/9 A from A to B through E
5 A from B to A through E
0.2 A from B to A through E
0.5 A from A to B through E
The temperature of a gas is –50° C. To what temperature the gas should be heated so that the rms speed is increased by 3 times?
3097 K
223 K
669° C
3295° C
A 12 V, 60 W lamp is connected to the secondary of a step down transformer, whose primary is connected to ac mains of 220 V. Assuming the transformer to be ideal, what is the current in the primary winding?
7 A
0.37 A
0.27 A
7 A
Two bodies of mass m and 9m are placed at a distance R. The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be (G = gravitational constant):
–16Gm/R
–20Gm/R
–8Gm/R
–12Gm/R
Let a wire be suspended from the ceiling (rigid support) and stretched by a weight W attached at its free end. The longitudinal stress at any point of cross-sectional area A of the wire is:
W/2A
Zero
2W/A
W/A
The angular acceleration of a body, moving along the circumference of a circle, is :
along the tangent to its position
along the axis of rotation
along the radius, away from centre
along the radius towards the centre
For the following logic circuit, the truth table is: Logic circuit with inputs A and B, each going through a NOT gate, then both outputs feeding into a NOR gate to produce output Y.
A B Y 0 0 1 0 1 0 1 0 1 1 1 0
A B Y 0 0 0 0 1 0 1 0 0 1 1 1
A B Y 0 0 1 0 1 1 1 0 1 1 1 0
A B Y 0 0 0 0 1 1 1 0 1 1 1 1
Two thin lenses are of same focal lengths (f), but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be :
f/2
Infinite
Zero
f/4
An electric dipole is placed as shown in the figure. Dipole with –q and +q charges separated by 6 cm, point P located 5 cm from center along perpendicular bisector. The electric potential (in 10² V) at point P due to the dipole is (ε₀=permittivity of free space and 1/(4πε₀) = K):
(8/5)qK
(8/3)qK
(3/8)qK
(5/8)qK
The x-t graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the particle at t=2 s is : [Diagram: A graph of x (m) vs t (s). The curve is a sine wave starting at (0,0), peaking at (2,1), crossing zero at (4,0), reaching a trough at (6,-1), and returning to zero at (8,0).]
-π²/16 m s⁻²
π²/16 m s⁻²
π²/8 m s⁻²
-π²/8 m s⁻²
10 resistors, each of resistance R are connected in series to a battery of emf E and negligible internal resistance. Then those are connected in parallel to the same battery, the current is increased n times. The value of n is :
1
1000
10
100
The resistance of platinum wire at 0°C is 2Ω and 6.8Ω at 80°C. The temperature coefficient of resistance of the wire is :
3×10⁻¹ °C⁻¹
3×10⁻⁴ °C⁻¹
3×10⁻³ °C⁻¹
3×10⁻² °C⁻¹
The radius of inner most orbit of hydrogen atom is 5.3×10⁻¹¹ m. What is the radius of third allowed orbit of hydrogen atom?
59 Å
77 Å
0.53 Å
06 Å
A very long conducting wire is bent in a semi-circular shape from A to B as shown in figure. The magnetic field at point P for steady current configuration is given by : [Diagram: A straight wire segment with current i→ enters from left, bends into a semi-circular arc of radius R from point A to B, then continues as a straight wire segment with current i← exiting to the left. Point P is located at the center of the semi-circle.]
(μ₀i)/(4R)[1 - 2/π] pointed away from page
(μ₀i)/(4R)[1 - 2/π] pointed into the page
(μ₀i)/(4R) pointed into the page
(μ₀i)/(4R) pointed away from the page
A satellite is orbiting just above the surface of the earth with period T. If d is the density of the earth and G is the universal constant of gravitation, the quantity 3π/(Gd) represents :
√T
T
T²
T³
A bullet from a gun is fired on a rectangular wooden block with velocity u. When bullet travels 24 cm through the block along its length horizontally, velocity of bullet becomes u/3. Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is :
28 cm
30 cm
27 cm
24 cm
The net impedance of circuit (as shown in figure) will be: Circuit with 50/π mH inductor, 10/π μF capacitor, 10 Ω resistor, connected to 220 V, 50 Hz AC source.
5√5 Ω
25 Ω
10√2 Ω
15 Ω
A wire carrying a current I along the positive x-axis has length L. It is kept in a magnetic field B⃗ = (2î + 3ĵ - 4k̂) T. The magnitude of the magnetic force acting on the wire is :
√5 IL
√3 IL
3 IL
5 IL
Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is 0.15 (g = 10 m s⁻²).
5 m s⁻²
50 m s⁻²
2 m s⁻²
150 m s⁻²
In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are thin)? n₁=1.5, R₁=R₂=20 cm, n₂=1.6
–100 cm
–50 cm
40 cm
–40 cm
A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity 4 m s⁻¹. The ball strikes the water surface after 4 s. The height of bridge above water surface is (Take g = 10 m s⁻²) :
64 m
68 m
56 m
60 m
For a certain reaction, the rate = k[A]²[B], when the initial concentration of A is tripled keeping concentration of B constant, the initial rate would
increase by a factor of nine.
increase by a factor of three.
decrease by a factor of nine.
increase by a factor of six.
Select the correct statements from the following : A. Atoms of all elements are composed of two fundamental particles. B. The mass of the electron is 9.10939 × 10⁻³¹ kg. C. All the isotopes of a given element show same chemical properties. D. Protons and electrons are collectively known as nucleons. E. Dalton’s atomic theory, regarded the atom as an ultimate particle of matter. Choose the correct answer from the options given below :
A and E only
B, C and E only
A, B and C only
C, D and E only
Match List - I with List - II : List - I A. Coke B. Diamond C. Fullerene D. Graphite List - II I. Carbon atoms are sp³ hybridised. II. Used as a dry lubricant III. Used as a reducing agent IV. Cage like molecules Choose the correct answer from the options given below :
A-III, B-I, C-IV, D-II
A-III, B-IV, C-I, D-II
A-II, B-IV, C-I, D-III
A-IV, B-I, C-II, D-III
Which one is an example of heterogenous catalysis?
Decomposition of ozone in presence of nitrogen monoxide.
Combination between dinitrogen and dihydrogen to form ammonia in the presence of finely divided iron.
Oxidation of sulphur dioxide into sulphur trioxide in the presence of oxides of nitrogen.
Hydrolysis of sugar catalysed by H⁺ ions.
In Lassaigne’s extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with Fe³⁺ due to the formation of -
[Fe(CN)₅NOS]⁴⁻
[Fe(SCN)]²⁺
Fe₄[Fe(CN)₆]₃ · xH₂O
NaSCN
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: Helium is used to dilute oxygen in diving apparatus. Reason R: Helium has high solubility in O₂. In the light of the above statements, choose the correct answer from the options given below:
A is true but R is false.
A is false but R is true.
Both A and R are true and R is the correct explanation of A.
Both A and R are true and R is NOT the correct explanation of A.
Which amongst the following molecules on polymerization produces neoprene?
H₂C=CH−C≡CH
H₂C=C(CH₃)−CH=CH₂
H₂C=CH−CH=CH₂
H₂C=C(Cl)−CH=CH₂
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: A reaction can have zero activation energy. Reasons R: The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy. In the light of the above statements, choose the correct answer from the options given below:
A is true but R is false.
A is false but R is true.
Both A and R are true and R is the correct explanation of A.
Both A and R are true and R is NOT the correct explanation of A.
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: In equation ΔᵣG = −nFE_cell, value of ΔᵣG depends on n. Reasons R: E_cell is an intensive property and ΔᵣG is an extensive property. In the light of the above statements, choose the correct answer from the options given below:
A is true but R is false.
A is false but R is true.
Both A and R are true and R is the correct explanation of A.
Both A and R are true and R is NOT the correct explanation of A.
Consider the following reaction and identify the product (P). CH₃ - CH - CH - CH₃ (with CH₃ below first CH and OH below second CH) + HBr → Product (P) 3 - Methylbutan - 2 - ol
CH₃ - CH - CH - CH₃ (with CH₃ below first CH and Br below second CH)
CH₃ - C - CH₂Br (with CH₃ above and below C)
CH₃ - C - CH₂ - CH₃ (with Br above C and CH₃ below C)
CH₃CH = CH - CH₃
Given below are two statements: Statement I: A unit formed by the attachment of a base to 1' position of sugar is known as nucleoside. Statement II: When nucleoside is linked to phosphorous acid at 5'-position of sugar moiety, we get nucleotide. In the light of the above statements, choose the correct answer from the options given below:
Statement I is true but Statement II is false.
Statement I is false but Statement II is true.
Both Statement I and Statement II are true.
Both Statement I and Statement II are false.
Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic. Reasons R : The deep blue solution is due to the formation of amide. In the light of the above statements, choose the correct answer from the options given below :
A is true but R is false.
A is false but R is true.
Both A and R are true and R is the correct explanation of A.
Both A and R are true but R is NOT the correct explanation of A.
Homoleptic complex from the following complexes is :
Pentaamminecarbonatocobalt (III) chloride
Triamminetriaquachromium (III) chloride
Potassium trioxalatoaluminate (III)
Diamminechloridonitrito - N - platinum (II)
Amongst the given options which of the following molecules/ion acts as a Lewis acid?
BF₃
OH⁻
NH₃
H₂O
The conductivity of centimolar solution of KCl at 25°C is 0.0210 ohm⁻¹ cm⁻¹ and the resistance of the cell containing the solution at 25°C is 60 ohm. The value of cell constant is -
26 cm⁻¹
34 cm⁻¹
34 cm⁻¹
28 cm⁻¹
The relation between nₘ, (nₘ = the number of permissible values of magnetic quantum number (m)) for a given value of azimuthal quantum number (l), is
nₘ = 2l² + 1
nₘ = l + 2
l = (nₘ - 1)/2
l = 2nₘ + 1
Identify product (A) in the following reaction: [Chemical structure of a diketone with a benzene ring attached to a cyclohexane ring, undergoing reduction with Zn-Hg and conc. HCl to give (A) + 2H₂O]
CH₂OH attached to cyclohexane and CH₂OH attached to benzene ring
CH₃ attached to cyclohexane and CH₃ attached to benzene ring
Ethyl group attached to cyclohexane and ethyl group attached to benzene ring
OH attached to cyclohexane and OH attached to benzene ring
Which of the following statements are NOT correct? A. Hydrogen is used to reduce heavy metal oxides to metals. B. Heavy water is used to study reaction mechanism. C. Hydrogen is used to make saturated fats from oils. D. The H-H bond dissociation enthalpy is lowest as compared to a single bond between two atoms of any element. E. Hydrogen reduces oxides of metals that are more active than iron. Choose the most appropriate answer from the options given below:
D, E only
A, B, C only
B, C, D, E only
B, D only
The right option for the mass of CO₂ produced by heating 20 g of 20% pure limestone is (Atomic mass of Ca = 40) [CaCO₃ →(1200 K) CaO + CO₂]
64 g
32 g
12 g
76 g
Complete the following reaction : [A] (cyclohexanone) + HCN → [B] (cyanohydrin) → [C] (under conc. H₂SO₄, Δ) [C] is ________.
cyclohexene carboxylic acid
cyclohexene carbaldehyde
cyclohexanol
cyclohexanecarboxylic acid
The number of σ bonds, π bonds and lone pair of electrons in pyridine, respectively are:
11, 3, 1
12, 2, 1
11, 2, 0
12, 3, 0
Which of the following reactions will NOT give primary amine as the product?
CH₃NC →(i) LiAlH₄, (ii) H₃O⁺ Product
CH₃CONH₂ →(i) LiAlH₄, (ii) H₃O⁺ Product
CH₃CONH₂ → Br₂ / KOH Product
CH₃CN →(i) LiAlH₄, (ii) H₃O⁺ Product
Which one of the following statements is correct?
The bone in human body is an inert and unchanging substance.
Mg plays roles in neuromuscular function and interneuronal transmission.
The daily requirement of Mg and Ca in the human body is estimated to be 0.2 - 0.3 g.
All enzymes that utilise ATP in phosphate transfer require Ca as the cofactor.
Taking stability as the factor, which one of the following represents correct relationship?
AlCl > AlCl₃
TlI > TlI₃
TlCl₃ > TlCl
InI₃ > InI
A compound is formed by two elements A and B. The element B forms cubic close packed structure and atoms of A occupy 1/3 of tetrahedral voids. If the formula of the compound is AₓBᵧ, then the value of x + y is in option
3
2
5
4
The element expected to form largest ion to achieve the nearest noble gas configuration is:
N
Na
O
F
The stability of Cu²⁺ is more than Cu⁺ salts in aqueous solution due to -
hydration energy.
second ionisation enthalpy.
first ionisation enthalpy.
enthalpy of atomization.
Some tranquilizers are listed below. Which one from the following belongs to barbiturates?
Valium
Veronal
Chlordiazepoxide
Meprobamate
Weight (g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with sodium hydroxide in presence of calcium oxide is:
30
18
16
32
Amongst the following, the total number of species NOT having eight electrons around central atom in its outer most shell, is NH₃, AlCl₃, BeCl₂, CCl₄, PCl₅ :
4
1
3
2
Identify the product in the following reaction: [Reaction scheme: benzene diazonium chloride reacts with (i) Cu2Br2/HBr, (ii) Mg/dry ether, (iii) H2O to give Product] Options show: (1) p-bromophenol, (2) phenol, (3) benzene, (4) phenylmagnesium bromide
phenol
p-bromophenol
phenylmagnesium bromide
benzene
Intermolecular forces are forces of attraction and repulsion between interacting particles that will include : A. dipole - dipole forces. B. dipole - induced dipole forces. C. hydrogen bonding. D. covalent bonding. E. dispersion forces. Choose the most appropriate answer from the options given below :
A, B, C, E are correct.
A, C, D, E are correct.
B, C, D, E are correct.
A, B, C, D are correct.
Which amongst the following options is correct graphical representation of Boyle’s Law?
Graph of P vs 1/V with three curves labeled T₁, T₂, T₃ where T₃ > T₂ > T₁
Graph of P vs T with three lines labeled V₁, V₂, V₃ where V₁ < V₂ < V₃
Graph of P vs V with three curves labeled T₁, T₂, T₃ where T₃ > T₂ > T₁
Graph of P vs 1/V with three lines labeled T₁, T₂, T₃ where T₃ > T₂ > T₁
The correct order of energies of molecular orbitals of N₂ molecule, is :
σ 1s < σ* 1s < σ 2s < σ* 2s < σ 2p_z < σ* 2p_z < (π2pₓ = π2pᵧ) < (π*2pₓ = π*2pᵧ)
σ 1s < σ* 1s < σ 2s < σ* 2s < (π2pₓ = π2pᵧ) < (π*2pₓ = π*2pᵧ) < σ 2p_z < σ* 2p_z
σ 1s < σ* 1s < σ 2s < σ* 2s < (π2pₓ = π2pᵧ) < σ 2p_z < (π*2pₓ = π*2pᵧ) < σ* 2p_z
σ 1s < σ* 1s < σ 2s < σ* 2s < σ 2p_z < (π2pₓ = π2pᵧ) < (π*2pₓ = π*2pᵧ) < σ* 2p_z
The equilibrium concentrations of the species in the reaction A + B ⇌ C + D are 2, 3, 10 and 6 mol L⁻¹, respectively at 300 K. ΔG° for the reaction is (R = 2 cal / mol K)
−1381.80 cal
−13.73 cal
1372.60 cal
−137.26 cal
What fraction of one edge centred octahedral void lies in one unit cell of fcc?
1/4
1/12
1/2
1/3
Consider the following compounds/species: i. [naphthalene structure] ii. [cyclopentadienyl anion structure] iii. [cyclobutadiene structure] iv. [cyclopropenyl anion structure] v. [cyclopropenyl cation structure] vi. [cyclooctatetraene structure] vii. [anthracene structure] The number of compounds/species which obey Huckel’s rule is ______.
2
5
4
6
The reaction that does NOT take place in a blast furnace between 900 K to 1500 K temperature range during extraction of iron is :
C + CO₂ → 2CO
CaO + SiO₂ → CaSiO₃
Fe₂O₃ + CO → 2FeO + CO₂
FeO + CO → Fe + CO₂
Which amongst the following will be most readily dehydrated under acidic conditions?
Structure with two OH groups and a CH₃ group on adjacent carbons
Structure with NO₂ and OH groups on adjacent carbons in a chain
Structure with NO₂, H, OH, and OH groups on adjacent carbons
Structure with NO₂, OH, and CH₃ groups on adjacent carbons
Which of the following statements are INCORRECT? A. All the transition metals except scandium form MO oxides which are ionic. B. The highest oxidation number corresponding to the group number in transition metal oxides is attained in Sc₂O₃ to Mn₂O₇. C. Basic character increases from V₂O₃ to V₂O₄ to V₂O₅. D. V₂O₄ dissolves in acids to give VO₃⁻ salts. E. CrO is basic but Cr₂O₃ is amphoteric. Choose the correct answer from the options given below :
C and D only
B and C only
A and E only
B and D only
Pumice stone is an example of -
solid sol
foam
sol
gel
Identify the major product obtained in the following reaction : [Chemical structure of o-phthalaldehyde] + 2[Ag(NH₃)₂]⁺ + 3⁻OH → major product
OH group on benzene ring with COO⁻ at ortho position
Carbonyl group on benzene ring with COO⁻ at ortho position
OH group on benzene ring with CH₂OH at ortho position
Carbonyl group on benzene ring with CH₂OH at ortho position
Match List - I with List - II : List - I (Oxoacids of Sulphur) A. Peroxodisulphuric acid B. Sulphuric acid C. Pyrosulphuric acid D. Sulphurous acid List - II (Bonds) I. Two S-OH, Four S=O, One S-O-S II. Two S-OH, One S=O III. Two S-OH, Four S=O, One S-O-O-S IV. Two S-OH, Two S=O
A-I, B-III, C-IV, D-II
A-III, B-IV, C-II, D-I
A-I, B-III, C-II, D-IV
A-III, B-IV, C-I, D-II
Given below are two statements : Statement I : The nutrient deficient water bodies lead to eutrophication. Statement II : Eutrophication leads to decrease in the level of oxygen in the water bodies. In the light of the above statements, choose the correct answer from the options given below :
Statement I is correct but Statement II is false.
Statement I is incorrect but Statement II is true.
Both Statement I and Statement II are true.
Both Statement I and Statement II are false.
Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?
ΔH - ΔU = - ΔnRT
ΔH + ΔU = ΔnR
ΔH = ΔU - Δn_gRT
ΔH = ΔU + Δn_gRT
Which complex compound is most stable?
[CoCl₂(en)₂]NO₃
[Co(NH₃)₆]₂(SO₄)₃
[Co(NH₃)₄(H₂O)Br](NO₃)₂
[Co(NH₃)₃(NO₃)₃]
Consider the following reaction : [Chemical structure of diphenyl ether] →[HI, Δ] A + B Identify products A and B.
A = benzyl iodide and B = phenol
A = toluene and B = iodobenzene
A = toluene and B = phenol
A = benzyl alcohol and B = iodobenzene
On balancing the given redox reaction, a Cr₂O₇²⁻ + b SO₃²⁻(aq) + c H⁺(aq) → 2a Cr³⁺(aq) + b SO₄²⁻(aq) + c/2 H₂O(ℓ) the coefficients a, b and c are found to be, respectively -
1, 8, 3
8, 1, 3
1, 3, 8
3, 8, 1
Identify the final product [D] obtained in the following sequence of reactions. CH₃CHO →[i) LiAlH₄, ii) H₃O⁺] [A] →[H₂SO₄, Δ] [B] →[HBr] [C] →[bromobenzene, Na/dry ether] [D]
C₄H₁₀
HC≡C⁻ Na⁺
[ethylbenzene structure]
[biphenyl structure]
Given below are two statements : Statement I : The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height. Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporative cooling. In the light of the above statements, choose the most appropriate answer from the options given below :
Statement I is correct but Statement II is incorrect.
Statement I is incorrect but Statement II is correct.
Both Statement I and Statement II are correct.
Both Statement I and Statement II are incorrect.
What is the function of tassels in the corn cob?
To disperse pollen grains
To protect seeds
To attract insects
To trap pollen grains
Movement and accumulation of ions across a membrane against their concentration gradient can be explained by
Passive Transport
Active Transport
Osmosis
Facilitated Diffusion
The reaction centre in PS II has an absorption maxima at
660 nm
780 nm
680 nm
700 nm
Axile placentation is observed in
Tomato, Dianthus and Pea
China rose, Petunia and Lemon
Mustard, Cucumber and Primrose
China rose, Beans and Lupin
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : ATP is used at two steps in glycolysis. Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate. In the light of the above statements, choose the correct answer from the options given below :
A is true but R is false.
A is false but R is true.
Both A and R are true and R is the correct explanation of A.
Both A and R are true but R is NOT the correct explanation of A.
Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?
Zeatin
Abscisic Acid
Indole-3-butyric Acid
Gibberellic Acid
Which hormone promotes internode/petiole elongation in deep water rice?
Ethylene
2, 4-D
GA₃
Kinetin
How many ATP and NADPH₂ are required for the synthesis of one molecule of Glucose during Calvin cycle?
12 ATP and 16 NADPH₂
18 ATP and 16 NADPH₂
12 ATP and 12 NADPH₂
18 ATP and 12 NADPH₂
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
Transcription of precursor of mRNA
Transcription of only snRNAs
Transcription of rRNAs (28S, 18S and 5.8S)
Transcription of tRNA, 5 srRNA and snRNA
The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
Diplotene
Diakinesis
Zygotene
Pachytene
In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :
Synergids, Zygote and Primary endosperm nucleus
Synergids, antipodals and Polar nuclei
Synergids, Primary endosperm nucleus and zygote
Antipodals, synergids, and primary endosperm nucleus
Which of the following stages of meiosis involves division of centromere?
Anaphase II
Telophase
Metaphase I
Metaphase II
In the equation GPP - R = NPP GPP is Gross Primary Productivity NPP is Net Primary Productivity R here is ____________.
Respiratory loss
Reproductive allocation
Photosynthetically active radiation
Respiratory quotient
Cellulose does not form blue colour with Iodine because
It does not contain complex helices and hence cannot hold iodine molecules.
It breakes down when iodine reacts with it.
It is a disaccharide.
It is a helical molecule.
The thickness of ozone in a column of air in the atmosphere is measured in terms of :
Decameter
Kilobase
Dobson units
Decibels
Upon exposure to UV radiation, DNA stained with ethidium bromide will show
Bright yellow colour
Bright orange colour
Bright red colour
Bright blue colour
Identify the pair of heterosporous pteridophytes among the following :
Psilotum and Salvinia
Equisetum and Salvinia
Lycopodium and Selaginella
Selaginella and Salvinia
Unequivocal proof that DNA is the genetic material was first proposed by
Avery, Macleoid and McCarthy
Wilkins and Franklin
Frederick Griffith
Alfred Hershey and Martha Chase
In gene gun method used to introduce alien DNA into host cells, microparticles of metal are used.
Tungsten or gold
Silver
Copper
Zinc
In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as -
Development
Senescence
Differentiation
Dedifferentiation
The phenomenon of pleiotropism refers to
a single gene affecting multiple phenotypic expression.
more than two genes affecting a single character.
presence of several alleles of a single gene controlling a single crossover.
presence of two alleles, each of the two genes controlling a single trait.
Given below are two statements : Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body. Statement II : Exarch condition is the most common feature of the root system. In the light of the above statements, choose the correct answer from the options given below :
Statement I is correct but Statement II is false.
Statement I is incorrect but Statement II is true.
Both Statement I and Statement II are true.
Both Statement I and Statement II are false.
Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.
Monoadelphous and Monothecous anthers
Epiphyllous and Dithecous anthers
Diadelphous and Dithecous anthers
Polyadelphous and epipetalous stamens
During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out
Histones
Polysaccharides
RNA
DNA
Identify the correct statements : A. Detrivores perform fragmentation. B. The humus is further degraded by some microbes during mineralization. C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching. D. The detritus food chain begins with living organisms. E. Earthworms break down detritus into smaller particles by a process called catabolism. Choose the correct answer from the options given below :
C, D, E only
D, E, A only
A, B, C only
B, C, D only
Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by
Alfred Sturtevant
Henking
Thomas Hunt Morgan
Sutton and Boveri
Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species?
Alien species invasions
Co-extinctions
Habitat loss and fragmentation
Over exploitation for economic gain
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage. Reason R : Protonema develops directly from spores produced in capsule. In the light of the above statements, choose the most appropriate answer from the options given below :
A is correct but R is not correct.
A is not correct but R is correct.
Both A and R are correct and R is the correct explanation of A.
Both A and R are correct but R is NOT the correct explanation of A.
Expressed Sequence Tags (ESTs) refers to
All genes whether expressed or unexpressed.
Certain important expressed genes.
All genes that are expressed as RNA.
All genes that are expressed as proteins.
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Late wood has fewer xylary elements with narrow vessels. Reason R : Cambium is less active in winters. In the light of the above statements, choose the correct answer from the options given below :
A is true but R is false.
A is false but R is true.
Both A and R are true and R is the correct explanation of A.
Both A and R are true but R is NOT the correct explanation of A.
The historic Convention on Biological Diversity, ‘The Earth Summit’ was held in Rio de Janeiro in the year :
1986
2002
1985
1992
Large, colourful, fragrant flowers with nectar are seen in :
bat pollinated plants
wind pollinated plants
insect pollinated plants
bird pollinated plants
Among eukaryotes, replication of DNA takes place in -
G₂ phase
G₁ phase
M phase
S phase
Which micronutrient is required for splitting of water molecule during photosynthesis?
magnesium
copper
manganese
molybdenum
Which one of the following statements is NOT correct?
Water hyacinth grows abundantly in eutrophic water bodies and leads to an imbalance in the ecosystem dynamics of the water body.
The amount of some toxic substances of industrial waste water increases in the organisms at successive trophic levels.
The micro-organisms involved in biodegradation of organic matter in a sewage polluted water body consume a lot of oxygen causing the death of aquatic organisms.
Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries.
Which of the following statements are correct about Klinefelter’s Syndrome? A. This disorder was first described by Langdon Down (1866). B. Such an individual has overall masculine development. However, the feminine development is also expressed. C. The affected individual is short statured. D. Physical, psychomotor and mental development is retarded. E. Such individuals are sterile. Choose the correct answer from the options given below :
B and E only
A and E only
A and B only
C and D only
Identify the correct statements : A. Lenticels are the lens-shaped openings permitting the exchange of gases. B. Bark formed early in the season is called hard bark. C. Bark is a technical term that refers to all tissues exterior to vascular cambium. D. Bark refers to periderm and secondary phloem. E. Phellogen is single-layered in thickness.
A, B and D only
B and C only
B, C and E only
A and D only
Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of
Lipase
Dinitrogenase
Succinic dehydrogenase
Amylase
Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence. A. Insertion of recombinant DNA into the host cell. B. Cutting of DNA at specific location by restriction enzyme. C. Isolation of desired DNA fragment. D. Amplification of gene of interest using PCR.
C, B, D, A
B, D, A, C
B, C, D, A
C, A, B, D
Match List I with List II : List I List II A. Iron I. Synthesis of auxin B. Zinc II. Component of nitrate reductase C. Boron III. Activator of catalase D. Molybdenum IV. Cell elongation and differentiation
A-III, B-I, C-IV, D-II
A-II, B-IV, C-I, D-III
A-III, B-II, C-I, D-IV
A-II, B-III, C-IV, D-I
Match List I with List II : List I A. Cohesion B. Adhesion C. Surface tension D. Guttaion List II I. More attraction in liquid phase II. Mutual attraction among water molecules III. Water loss in liquid phase IV. Attraction towards polar surfaces Choose the correct answer from the options given below :
A-III, B-I, C-IV, D-II
A-II, B-I, C-IV, D-III
A-II, B-IV, C-I, D-III
A-IV, B-III, C-II, D-I
Match List I with List II : List I List II A. Oxidative decarboxylation I. Citrate synthase B. Glycolysis II. Pyruvate dehydrogenase C. Oxidative phosphorylation III. Electron transport system D. Tricarboxylic acid cycle IV. EMP pathway
A-III, B-I, C-II, D-IV
A-II, B-IV, C-III, D-I
A-III, B-IV, C-II, D-I
A-II, B-IV, C-I, D-III
Match List I with List II : List I A. M Phase B. G₂ Phase C. Quiescent stage D. G₁ Phase List II I. Proteins are synthesized II. Inactive phase III. Interval between mitosis and initiation of DNA replication IV. Equational division Choose the correct answer from the options given below :
A-IV, B-I, C-II, D-III
A-II, B-IV, C-I, D-III
A-III, B-II, C-IV, D-I
A-IV, B-II, C-I, D-III
Which of the following combinations is required for chemiosmosis?
proton pump, electron gradient, ATP synthase
proton pump, electron gradient, NADP synthase
membrane, proton pump, proton gradient, ATP synthase
membrane, proton pump, proton gradient, NADP synthase
Given below are two statements : Statement I : Gause’s ‘Competitive Exclusion Principle’ states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually. Statement II : In general, carnivores are more adversely affected by competition than herbivores. In the light of the above statements, choose the correct answer from the options given below :
Statement I is correct but Statement II is false.
Statement I is incorrect but Statement II is true.
Both Statement I and Statement II are true.
Both Statement I and Statement II are false.
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air currents. Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed. In the light of the above statements, choose the correct answer from the options given below :
A is true but R is false.
A is false but R is true.
Both A and R are true and R is the correct explanation of A.
Both A and R are true but R is NOT the correct explanation of A.
Match List I with List II. List I: A. Ringworm, B. Filariasis, C. Malaria, D. Pneumonia. List II: I. Haemophilus influenzae, II. Trichophyton, III. Wuchereria bancrofti, IV. Plasmodium vivax. Choose the correct answer from the options given below:
A-II, B-III, C-I, D-IV
A-III, B-II, C-IV, D-I
A-III, B-II, C-I, D-IV
A-II, B-III, C-IV, D-I
How many different proteins does the ribosome consist of?
40
20
80
60
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem. Reason R : Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves. In the light of the above statements, choose the correct answer from the options given below :
A is true but R is false.
A is false but R is true.
Both A and R are true and R is the correct explanation of A.
Both A and R are true but R is NOT the correct explanation of A.
Given below are two statements: Statement I: Ligaments are dense irregular tissue. Statement II: Cartilage is dense regular tissue. In the light of the above statements, choose the correct answer from the options given below:
Statement I is true but Statement II is false.
Statement I is false but Statement II is true.
Both Statement I and Statement II are true.
Both Statement I and Statement II are false.
Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. In the light of the above statements, choose the correct answer from the options given below:
Statement I is true but Statement II is false.
Statement I false but Statement II is true.
Both Statement I and Statement II are true.
Both Statement I and Statement II are false.
Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?
Polymerase Chain Reaction (PCR) technique
Enzyme Linked Immuno-Sorbent Assay (ELISA) technique
Recombinant DNA Technology
Serum and Urine analysis
In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
Basophils
Eosinophils
Tₕ cells
B-lymphocytes
Which of the following is not a cloning vector?
pBR322
Probe
BAC
YAC
Given below are two statements: Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal) Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of α type and two subunits of β type.) In the light of the above statements, choose the correct answer from the options given below:
Statement I is true but Statement II is false.
Statement I is false but Statement II is true.
Both Statement I and Statement II are true.
Both Statement I and Statement II are false.
Given below are two statements: Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct. Statement II: The cavity of the cervix is called cervical canal which along with vagina forms birth canal. In the light of the above statements, choose the correct answer from the options given below:
Statement I is correct but Statement II is false.
Statement I incorrect but Statement II is true.
Both Statement I and Statement II are true.
Both Statement I and Statement II are false.
Which one of the following symbols represents mating between relatives in human pedigree analysis?
■ ● ◆
□—○
□=○
□—○ | ■
Vital capacity of lung is _______.
IRV + ERV + TV + RV
IRV + ERV + TV
IRV + ERV
IRV + ERV + TV – RV
Match List I with List II.
| List-I | List-II |
| A. P-wave | I. Beginning of systole |
| B. Q-wave | II. Repolarisation of ventricles |
| C. QRS complex | III. Depolarisation of atria |
| D. T-wave | IV. Depolarisation of ventricles |
Choose the correct answer from the options given below:
A-II, B-IV, C-I, D-III
A-I, B-II, C-III, D-IV
A-III, B-I, C-IV, D-II
A-IV, B-III, C-II, D-I
Radial symmetry is NOT found in adults of phylum ________.
Coelenterata
Echinodermata
Ctenophora
Hemichordata
Match List I with List II.
| List-I | List-II |
| A. Mast cells | I. Ciliated epithelium |
| B. Inner surface of bronchiole | II. Areolar connective tissue |
| C. Blood | III. Cuboidal epithelium |
| D. Tubular parts of nephron | IV. specialised connective tissue |
Choose the correct answer from the options give below:
A-I, B-II, C-IV, D-III
A-II, B-I, C-IV, D-III
A-III, B-IV, C-II, D-I
A-II, B-III, C-I, D-IV
Match List I with List II.
| List-I | List-II |
| A. Heroin | I. Effect on cardiovascular system |
| B. Marijuana | II. Slow down body function |
| C. Cocaine | III. Painkiller |
| D. Morphine | IV. Interfere with transport of dopamine |
Choose the correct answer from the options given below:
A-III, B-IV, C-I, D-II
A-II, B-I, C-IV, D-III
A-I, B-II, C-III, D-IV
A-IV, B-III, C-II, D-I
Match List I with List II. List I List II A. Vasectomy I. Oral method B. Coitus II. Barrier method interruptus C. Cervical caps III. Surgical method D. Saheli IV. Natural method Choose the correct answer from the options given below:
A-II, B-III, C-I, D-IV
A-IV, B-II, C-I, D-III
A-III, B-I, C-IV, D-II
A-III, B-IV, C-II, D-I
Match List I with List II. List I List II A. CCK I. Kidney B. GIP II. Heart C. ANF III. Gastric gland D. ADH IV. Pancreas Choose the correct answer from the options given below:
A-II, B-IV, C-I, D-III
A-IV, B-II, C-III, D-I
A-IV, B-III, C-II, D-I
A-III, B-II, C-IV, D-I
Broad palm with single palm crease is visible in a person suffering from-
Klinefelter’s syndrome
Thalassemia
Down’s syndrome
Turner’s syndrome
Match List I with List II.
| Interacting species | Name of Interaction |
| A. A Leopard and a Lion in a forest/grassland | I. Competition |
| B. A Cuckoo laying egg in a Crow’s nest | II. Brood parasitism |
| C. Fungi and root of a higher plant in Mycorrtizae | III. Mutualism |
| D. A cattle egret and a Cattle in a field | IV. Commensalism |
Choose the correct answer from the options given below:
A-III, B-IV, C-I, D-II
A-II, B-III, C-I, D-IV
A-I, B-II, C-III, D-IV
A-I, B-II, C-IV, D-III
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Endometrium is necessary for implantation of blastocyst. Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium. In the light of the above statements, choose the correct answer from the options given below:
A is true but R is false.
A is false but R is true.
Both A and R are true and R is the correct explanation of A.
Both A and R are true but R is NOT the correct explanation of A.
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme. Reason R: Ban on amniocentesis checks increasing menace of female foeticide. In the light of the above statements, choose the correct answer from the options given below:
A is true but R is false.
A is false but R is true.
Both A and R are true and R is the correct explanation of A.
Both A and R are true and R is NOT the correct explanation of A.
Which of the following functions is carried out by cytoskeleton in a cell?
Motility
Transportation
Nuclear division
Protein synthesis
Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.
Mole, Flying squirrel, Tasmanian tiger cat
Lemur, Anteater, Wolf
Tasmanian wolf, Bobcat, Marsupial mole
Numbat, Spotted cuscus, Flying phalanger
Which of the following statements are correct regarding female reproductive cycle? A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle. B. First menstrual cycle begins at puberty and is called menopause. C. Lack of menstruation may be indicative of pregnancy. D. Cyclic menstruation extends between menarche and menopause. Choose the most appropriate answer from the options given below:
A, B and C only
A, C and D only
A and D only
A and B only
Match List I with List II. List I List II A. Gene ‘a’ I. β-galactosidase B. Gene ‘y’ II. Transacetylase C. Gene ‘i’ III. Permease D. Gene ‘z’ IV. Repressor protein Choose the correct answer from the options given below:
A-III, B-IV, C-I, D-II
A-III, B-I, C-IV, D-II
A-II, B-I, C-IV, D-III
A-II, B-III, C-IV, D-I
Match List I with List II. List I (Type of Joint) List II (Found between) A. Cartilaginous Joint I. Between flat skull bones B. Ball and Socket Joint II. Between adjacent vertebrae in vertebral column C. Fibrous Joint III. Between carpal and metacarpal of thumb D. Saddle Joint IV. Between Humerus and Pectoral girdle Choose the correct answer from the options given below:
A-I, B-IV, C-III, D-II
A-II, B-IV, C-III, D-I
A-III, B-I, C-II, D-IV
A-II, B-IV, C-I, D-III
Given below are two statements: Statement I: Electrostatic precipitator is most widely used in thermal power plant. Statement II: Electrostatic precipitator in thermal power plant removes ionising radiations In the light of the above statements, choose the most appropriate answer from the options given below:
Statement I is correct but Statement II is incorrect.
Statement I incorrect but Statement II is correct.
Both Statement I and Statement II are correct.
Both Statement I and Statement II are incorrect.
Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?
Hepatitis-B
HIV Infection
Genital herpes
Gonorrhoea
Which of the following statements is correct?
Presence of large amount of nutrients in water restricts ‘Algal Bloom’
Algal Bloom decreases fish mortality
Eutrophication refers to increase in domestic sewage and waste water in lakes.
Biomagnification refers to increase in concentration of the toxicant at successive trophic levels.
Given below are two statements: Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat. Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor. In the light of the above statements, choose the correct answer from the options given below:
Statement I is true but Statement II is false.
Statement I is false but Statement II is true.
Both Statement I and Statement II are true.
Both Statement I and Statement II are false.
Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by-
Gastro - oesophageal sphincter
Pyloric sphincter
Sphincter of Oddi
Ileo - caecal valve
Match List I with List II with respect to human eye. List I A. Fovea B. Iris C. Blind spot D. Sclera List II I. Visible coloured portion of eye that regulates diameter of pupil. II. External layer of eye formed of dense connective tissue. III. Point of greatest visual acuity or resolution. IV. Point where optic nerve leaves the eyeball and photoreceptor cells are absent. Choose the correct answer from the options given below:
A-II, B-I, C-III, D-IV
A-III, B-I, C-IV, D-II
A-I, B-IV, C-III, D-II
A-IV, B-III, C-II, D-I
Which of the following are NOT considered as the part of endomembrane system? A. Mitochondria B. Endoplasmic Reticulum C. Chloroplasts D. Golgi complex E. Peroxisomes Choose the most appropriate answer from the options given below:
A and D only
A, D and E only
B and D only
A, C and E only
Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below:
Statement I is correct but Statement II is false.
Statement I incorrect but Statement II is true.
Both Statement I and Statement II are true.
Both Statement I and Statement II are false.
Match List I with List II. List I List II A. Taenia I. Nephridia B. Paramoecium II. Contractile vacuole C. Periplaneta III. Flame cells D. Pheretima IV. Ureose gland Choose the correct answer from the options give below:
A-I, B-II, C-IV, D-III
A-III, B-II, C-IV, D-I
A-II, B-I, C-IV, D-III
A-I, B-II, C-III, D-IV
Given below are statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla. Reason R: Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle. In the light of the above statements, choose the correct answer from the options given below:
A is true but R is false.
A is false but R is true.
Both A and R are true and R is the correct explanation of A.
Both A and R are true but R is NOT the correct explanation of A.
Which one of the following is NOT an advantage of inbreeding?
Elimination of less desirable genes and accumulation of superior genes takes place due to it.
It decreases the productivity of inbred population, after continuous inbreeding.
It decreases homozygosity.
It exposes harmful recessive genes that are eliminated by selection.
Given below are two statements: Statement I: During G₀ phase of cell cycle, the cell is metabolically inactive. Statement II: The centrosome undergoes duplication during S phase of interphase. In the light of the above statements, choose the most appropriate answer from the options given below:
Statement I is correct but Statement II is incorrect.
Statement I is incorrect but Statement II is correct.
Both Statement I and Statement II are correct.
Both Statement I and Statement II are incorrect.
The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are :
Brain stem & epithalamus
Corpus callosum and thalamus
Limbic system & hypothalamus
Corpora quadrigemina & hippocampus
Which of the following is characteristic feature of cockroach regarding sexual dimorphism ?
Presence of sclerites
Presence of anal cerci
Dark brown body colour and anal cerci
Presence of anal styles
The unique mammalian characteristics are:
hairs, pinna and indirect development
pinna, monocondylic skull and mammary glands
hairs, tympanic membrane and mammary glands
hairs, pinna and mammary glands
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3’?
5’ ATCGATCGATCGATCGATCG ATCGATCG 3’
3’ ATCGATCGATCGATCGATCG ATCGATCG 5’
5’ UAGCUAGCUAGCUAGCUA GCUAGC UAGC 3’
3’ UAGCUAGCUAGCUAGCUA GCUAGCUAGC 5’
In cockroach, excretion is brought about by-
Phallic gland
Ureose gland
Nephrocytes
Fat body
Which of the following statements are correct regarding skeletal muscle? A. Muscle bundles are held together by collagenous connective tissue layer called fascicle. B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions. C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins. D. M line is considered as functional unit of contraction called sarcomere. Choose the most appropriate answer from the options given below:
A, C and D only
C and D only
A, B and C only
B and C only
Which of the following are NOT under the control of thyroid hormone?
Maintenance of water and electrolyte balance
Regulation of basal metabolic rate
Normal rhythm of sleep-wake cycle
Development of immune system
Which of the following statements are correct ? A. Basophils are most abundant cells of the total WBCs B. Basophils secrete histamine, serotonin and heparin C. Basophils are involved in inflammatory response D. Basophils have kidney shaped nucleus E. Basophils are agranulocytes
B and C only
A and B only
D and E only
C and E only
Which of the following statements are correct? A. An excessive loss of body fluid from the body switches off osmoreceptors. B. ADH facilitates water reabsorption to prevent diuresis. C. ANF causes vasodilation. D. ADH causes increase in blood pressure. E. ADH is responsible for decrease in GFR.
A, B and E only
C, D and E only
A and B only
B, C and D only
Select the correct statements with reference to chordates. A. Presence of a mid-dorsal, solid and double nerve cord. B. Presence of closed circulatory system. C. Presence of paired pharyngeal gillslits. D. Presence of dorsal heart E. Triploblastic pseudocoelomate animals. Choose the correct answer from the options given below:
B, D and E only
C, D and E only
A, C and D only
B and C only
Select the correct statements. A. Tetrad formation is seen during Leptotene. B. During Anaphase, the centromeres split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi complex and ER are reformed during Telophase. E. Crossing over takes place between sister chromatids of homologous chromosome.
A, C and E only
B and E only
A and C only
B and D only
Match List I with List II.
| List-I | List-II |
| A. Logistic growth | I. Unlimited resource availability condition |
| B. Exponential growth | II. Limited resource availability condition |
| C. Expanding age pyramid | III. The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups |
| D. Stable age pyramid | IV. The percent individuals of pre-reproductives and reproductive age group are same |
A-II, B-IV, C-I, D-III
A-II, B-IV, C-III, D-I
A-II, B-I, C-III, D-IV
A-II, B-III, C-I, D-IV
Note the chapters where you slipped up in this paper, then revise via NCERT-aligned notes, interactive widgets, and chapter-wise mock tests for all four subjects.
Physics
28 NEET chapters
Chemistry
28 NEET chapters
Botany
18 NEET chapters
Source: National Testing Agency (NTA), NEET-UG 2023 Question Paper, Code H5. Solutions written for educational use, NCERT-aligned. Verify your answers against the official NTA answer key.