NEET 2024 — Code Q1

A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is v in the direction shown, which one of the following options is correct (P and Q are any highest and lowest points on the wheel, respectively)?

In the following circuit, the equivalent capacitance between terminal A and terminal B is :

At any instant of time t, the displacement of any particle is given by 2t – 1 (SI unit) under the influence of force of 5 N. The value of instantaneous power is (in SI unit):

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: The potential (V) at any axial point, at 2 m distance (r) from the centre of the dipole of dipole moment vector P of magnitude, $4\times 10^{-6}$ C m, is $\pm 9\times 10^3$ V. (Take $\frac{1}{4\pi {ϵ}_0}=9\times 10^9$ SI units) Reason R: $V=\pm \frac{2P}{4\pi {ϵ}_0{r}^2}$, where r is the distance of any axial point, situated at 2 m from the centre of the dipole. In the light of the above statements, choose the correct answer from the options given below:

Two bodies A and B of same mass undergo completely inelastic one dimensional collision. The body A moves with velocity $v_1$ while body B is at rest before collision. The velocity of the system after collision is $v_2$. The ratio $v_1:v_2$ is

In a uniform magnetic field of $0.049$ T, a magnetic needle performs 20 complete oscillations in 5 seconds as shown. The moment of inertia of the needle is $9.8\times 10^{-6}$ kg m${}^2$. If the magnitude of magnetic moment of the needle is $x\times 10^{-5}$ Am${}^2$, then the value of ‘$x$’ is :

An unpolarised light beam strikes a glass surface at Brewster's angle. Then

Consider the following statements A and B and identify the correct answer: A. For a solar cell, the I - V characteristics lies in the IV quadrant of the given graph. B. In a reverse biased pn junction diode, the current measured in ($\mu$A), is due to majority charge carriers.

The graph which shows the variation of $\left(\frac{1}{{\lambda }^2}\right)$ and its kinetic energy, $E$ is (where $\lambda$ is de Broglie wavelength of a free particle):

The terminal voltage of the battery, whose emf is 10 V and internal resistance 1 Ω, when connected through an external resistance of 4 Ω as shown in the figure is:

The quantities which have the same dimensions as those of solid angle are:

In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of induced current in solenoid-1 and that in solenoid-2, respectively, are through the directions:

The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod is $2400$ g cm${}^2$. The length of the $400$ g rod is nearly:

If $5\sin \left(\frac{\pi }{3}t\right)=\pi +x$ represents the motion of a particle executing simple harmonic motion, the amplitude and time period of motion, respectively, are

The mass of a planet is $\frac{1}{10}$ that of the earth and its diameter is half that of the earth. The acceleration due to gravity on that planet is:

A horizontal force 10 N is applied to a block A as shown in figure. The mass of blocks A and B are 2 kg and 3 kg respectively. The blocks slide over a frictionless surface. The force exerted by block A on block B is :

A thermodynamic system is taken through the cycle abcda. The work done by the gas along the path bc is:

In the nuclear emission stated above, the mass number and atomic number of the product Q respectively, are

A particle moving with uniform speed in a circular path maintains:

A light ray enters through a right angled prism at point P with the angle of incidence 30° as shown in figure. It travels through the prism parallel to its base BC and emerges along the face AC. The refractive index of the prism is:

In a vernier callipers, ( N + 1) divisions of vernier scale coincide with N divisions of main scale. If 1 MSD represents 0.1 mm, the vernier constant (in cm) is:

If the monochromatic source in Young’s double slit experiment is replaced by white light, then

If c is the velocity of light in free space, the correct statements about photon among the following are: A. The energy of a photon is E = hν. B. The velocity of a photon is c. C. The momentum of a photon, p = $\frac{h\nu }{c}$. D. In a photon-electron collision, both total energy and total momentum are conserved. E. Photon possesses positive charge. Choose the correct answer from the options given below:

The output (Y) of the given logic gate is similar to the output of an/a

A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If surface tension of water is 0.07 N m⁻¹, then the excess force required to take it away from the surface is

In an ideal transformer, the turns ratio is $\frac{N_P}{N_S}=\frac{1}{2}$. The ratio $V_S:V_P$ is equal to (the symbols carry their usual meaning) :

The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young's modulus, respectively, are $8\times 10^8{\text{ N m}}^{-2}$ and $2\times 10^{11}{\text{ N m}}^{-2}$, is:

A thin spherical shell is charged by some source. The potential difference between the two points C and P (in V) shown in the figure is: (Take $\frac{1}{4\pi {ϵ}_0}=9\times 10^9$ SI units)

A wire of length 'l' and resistance 100 Ω is divided into 10 equal parts. The first 5 parts are connected in series while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is:

A tightly wound 100 turns coil of radius 10 cm carries a current of 7 A. The magnitude of the magnetic field at the centre of the coil is (Take permeability of free space as $4\pi \times 10^{-7}$ SI units):

A bob is whirled in a horizontal plane by means of a string with an initial speed of $\omega$ rpm. The tension in the string is T. If speed becomes $2\omega$ while keeping the same radius, the tension in the string becomes:

A parallel plate capacitor is charged by connecting it to a battery through a resistor. If I is the current in the circuit, then in the gap between the plates:

A 10 μF capacitor is connected to a 210 V, 50 Hz source as shown in figure. The peak current in the circuit is nearly (π = 3.14):

If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its original length, then the new time period of oscillation is $2x$ times its original time period. Then the value of $x$ is:

The following graph represents the $T-V$ curves of an ideal gas (where $T$ is the temperature and $V$ the volume) at three pressures $P_1$, $P_2$ and $P_3$ compared with those of Charles’s law represented as dotted lines. Then the correct relation is:

The minimum energy required to launch a satellite of mass m from the surface of earth of mass M and radius R in a circular orbit at an altitude of 2R from the surface of the earth is:

The property which is not of an electromagnetic wave travelling in free space is that:

Choose the correct circuit which can achieve the bridge balance.

A force defined by $F=\alpha t^2+\beta t$ acts on a particle at a given time $t$. The factor which is dimensionless, if $\alpha$ and $\beta$ are constants, is:

Two heaters A and B have power rating of 1 kW and 2 kW, respectively. Those two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:

An iron bar of length $L$ has magnetic moment $M$. It is bent at the middle of its length such that the two arms make an angle 60° with each other. The magnetic moment of this new magnet is :

A metallic bar of Young’s modulus, $0.5\times 10^{11}$ N m${}^{-2}$ and coefficient of linear thermal expansion $10^{-5}$ °C${}^{-1}$, length 1 m and area of cross-section $10^{-3}$ m${}^2$ is heated from 0°C to 100°C without expansion or bending. The compressive force developed in it is :

The velocity (v) – time (t) plot of the motion of a body is shown below: [Diagram: A velocity-time graph showing a trapezoidal shape starting at origin, rising linearly, then flat, then falling linearly back to zero on the time axis.] The acceleration (a) – time (t) graph that best suits this motion is :

If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then A. the charge stored in it, increases. B. the energy stored in it, decreases. C. its capacitance increases. D. the ratio of charge to its potential remains the same. E. the product of charge and voltage increases. Choose the most appropriate answer from the options given below: (1) A, B and E only (2) A, C and E only (3) B, D and E only (4) A, B and C only

A small telescope has an objective of focal length 140 cm and an eye piece of focal length 5.0 cm. The magnifying power of telescope for viewing a distant object is:

A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to: A. hold the sheet there if it is magnetic. B. hold the sheet there if it is non-magnetic. C. move the sheet away from the pole with uniform velocity if it is conducting. D. move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar. Choose the correct statement(s) from the options given below:

The energy of an electron in the ground state (n = 1) for He⁺ ion is –x J, then that for an electron in n = 2 state for Be³⁺ ion in J is

Given below are two statements: Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges. Statement II: Atoms of each element are stable and emit their characteristic spectrum. In the light of the above statements, choose the most appropriate answer from the options given below.

Arrange the following elements in increasing order of electronegativity: N, O, F, C, Si

Identify the correct reagents that would bring about the following transformation.

The compound that will undergo S${}_N$1 reaction with the fastest rate is

For the reaction $2A\rightleftharpoons B+C$, $K_c=4\times 10^{-3}$. At a given time, the composition of reaction mixture is: $[A]=[B]=[C]=2\times 10^{-3}$ M. Then, which of the following is correct?

The highest number of helium atoms is in

Match List I with List II. List I (Compound) List II (Shape/geometry) A. NH${}_3$ I. Trigonal Pyramidal B. BrF${}_5$ II. Square Planar C. XeF${}_4$ III. Octahedral D. SF${}_6$ IV. Square Pyramidal Choose the correct answer from the options given below:

The E° value for the Mn${}^{3+}$/Mn${}^{2+}$ couple is more positive than that of Cr${}^{3+}$/Cr${}^{2+}$ or Fe${}^{3+}$/Fe${}^{2+}$ due to change of

In which of the following equilibria, $K_p$ and $K_c$ are NOT equal?

Among Group 16 elements, which one does NOT show –2 oxidation state?

'Spin only' magnetic moment is same for which of the following ions? A. ${\text{Ti}}^{3+}$ B. ${\text{Cr}}^{2+}$ C. ${\text{Mn}}^{2+}$ D. ${\text{Fe}}^{2+}$ E. ${\text{Sc}}^{3+}$ Choose the most appropriate answer from the options given below.

A compound with a molecular formula of $C_6{H}_{14}$ has two tertiary carbons. Its IUPAC name is :

Given below are two statements: Statement I : The boiling point of three isomeric pentanes follows the order n-pentane > isopentane > neopentane Statement II : When branching increases, the molecule attains a shape of sphere. This results in smaller surface area for contact, due to which the intermolecular forces between the spherical molecules are weak, thereby lowering the boiling point. In the light of the above statements, choose the most appropriate answer from the options given below:

Which plot of $\ln k$ vs $\frac{1}{T}$ is consistent with Arrhenius equation?

The Henry’s law constant ($K_H$) values of three gases (A, B, C) in water are 145, $2\times 10^{-5}$ and 35 kbar, respectively. The solubility of these gases in water follow the order:

Fehling's solution 'A' is

Given below are two statements: Statement I: The boiling point of hydrides of Group 16 elements follow the order H₂O > H₂Te > H₂Se > H₂S. Statement II: On the basis of molecular mass, H₂O is expected to have lower boiling point than the other members of the group but due to the presence of extensive H-bonding in H₂O, it has higher boiling point. In the light of the above statements, choose the correct answer from the options given below:

Given below are two statements: Statement I: Both [Co(NH₃)₆]³⁺ and [CoF₆]³⁻ complexes are octahedral but differ in their magnetic behaviour. Statement II: [Co(NH₃)₆]³⁺ is diamagnetic whereas [CoF₆]³⁻ is paramagnetic. In the light of the above statements, choose the correct answer from the options given below:

The most stable carbocation among the following is:

On heating, some solid substances change from solid to vapour state without passing through liquid state. The technique used for the purification of such solid substances based on the above principle is known as

The reagents with which glucose does not react to give the corresponding tests/products are A. Tollen's reagent B. Schiff's reagent C. HCN D. NH₂OH E. NaHSO₃ Choose the correct options from the given below:

Activation energy of any chemical reaction can be calculated if one knows the value of

Intramolecular hydrogen bonding is present in

Given below are two statements: Statement I : Aniline does not undergo Friedel-Crafts alkylation reaction. Statement II : Aniline cannot be prepared through Gabriel synthesis. In the light of the above statements, choose the correct answer from the options given below:

Which one of the following alcohols reacts instantaneously with Lucas reagent?

Arrange the following elements in increasing order of first ionization enthalpy: Li, Be, B, C, N Choose the correct answer from the options given below:

Which reaction is NOT a redox reaction?

In which of the following processes entropy increases?

1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide left unreacted is equal to

The products A and B obtained in the following reactions, respectively, are \ 3ROH + PCl_3 → 3RCl + A \ ROH + PCl_5 → RCl + HCl + B

Major products A and B formed in the following reaction sequence, are

Identify the major product C formed in the following reaction sequence: $\text{NaCN}\to {\text{CH}}_3{\text{CH}}_2{\text{CH}}_2\text{I}\to \text{A}\stackrel{\text{NaOH, Partial hydrolysis}}{\to }\text{B}\stackrel{\text{Br}}{\to }\text{C}(\text{major})$

During the preparation of Mohr’s salt solution (Ferrous ammonium sulphate), which of the following acid is added to prevent hydrolysis of ${\text{Fe}}^{2+}$ ion?

Consider the following reaction in a sealed vessel at equilibrium with concentrations of ${\text{N}}_2=3.0\times 10^{-3}\text{ M}$, ${\text{O}}_2=4.2\times 10^{-3}\text{ M}$ and $\text{NO}=2.8\times 10^{-3}\text{ M}$. $2\text{NO}(g)\rightleftharpoons {\text{N}}_2(g)+{\text{O}}_2(g)$ If $0.1{\text{ mol L}}^{-1}$ of $\text{NO}(g)$ is taken in a closed vessel, what will be degree of dissociation ($\alpha$) of $\text{NO}(g)$ at equilibrium?

The work done during reversible isothermal expansion of one mole of hydrogen gas at 25°C from pressure of 20 atmosphere to 10 atmosphere is (Given $R=2.0{\text{ cal K}}^{-1}{\text{ mol}}^{-1}$)

Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution for 100 seconds is (Given: Molar mass of Cu: 63 g mol${}^{-1}$, 1 F = 96487 C)

The rate of a reaction quadruples when temperature changes from 27°C to 57°C. Calculate the energy of activation. Given $R=8.314{\text{ J K}}^{-1}{\text{ mol}}^{-1}$, $\log 4=0.6021$

The plot of osmotic pressure ($\Pi$) vs concentration (mol L${}^{-1}$) for a solution gives a straight line with slope 25.73 L bar mol${}^{-1}$. The temperature at which the osmotic pressure measurement is done is (Use $R=0.083{\text{ L bar mol}}^{-1}{\text{ K}}^{-1}$)

Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to VI. A. Al³⁺ B. Cu²⁺ C. Ba²⁺ D. Co²⁺ E. Mg²⁺ Choose the correct answer from the options given below.

Given below are two statements: Statement I: [Co(NH₃)₆]³⁺ is a homoleptic complex whereas [Co(NH₃)₄Cl₂]⁺ is a heteroleptic complex. Statement II: Complex [Co(NH₃)₆]³⁺ has only one kind of ligands but [Co(NH₃)₄Cl₂]⁺ has more than one kind of ligands. In the light of the above statements, choose the correct answer from the options given below.

The pair of lanthanoid ions which are diamagnetic is

For the given reaction: ‘P’ is

Identify the correct answer.

A compound X contains 32% of A, 20% of B and remaining percentage of C. Then, the empirical formula of X is : (Given atomic masses of A = 64; B = 40; C = 32 u)

Match List I with List II

Identify the part of the seed from the given figure which is destined to form root when the seed germinates.

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin

These are regarded as major causes of biodiversity loss: A. Over exploitation B. Co-extinction C. Mutation D. Habitat loss and fragmentation E. Migration Choose the correct option:

Spindle fibers attach to kinetochores of chromosomes during

Which of the following is an example of actinomorphic flower?

The capacity to generate a whole plant from any cell of the plant is called:

Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:

Identify the set of correct statements: A. The flowers of Vallisneria are colourful and produce nectar. B. The flowers of water lily are not pollinated by water. C. In most of water-pollinated species, the pollen grains are protected from wetting. D. Pollen grains of some hydrophytes are long and ribbon like. E. In some hydrophytes, the pollen grains are carried passively inside water. Choose the correct answer from the options given below.

Given below are two statements: Statement I : Parenchyma is living but collenchyma is dead tissue. Statement II : Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms. In the light of the above statements, choose the correct answer from the options given below:

Formation of interfascicular cambium from fully developed parenchyma cells is an example for

Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:

Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b)

In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?

Tropical regions show greatest level of species richness because

The equation of Verhulst-Pearl logistic growth is $\frac{dN}{dt}=rN\left[\frac{K-N}{K}\right]$. From this equation, K indicates:

In the given figure, which component has thin outer walls and highly thickened inner walls?

Given below are two statements: Statement I: Chromosomes become gradually visible under light microscope during leptotene stage. Statement II: The beginning of diplotene stage is recognized by dissolution of synaptonemal complex. In the light of the above statements, choose the correct answer from the options given below:

List of endangered species was released by

Which of the following are required for the dark reaction of photosynthesis? A. Light B. Chlorophyll C. CO₂ D. ATP E. NADPH Choose the correct answer from the options given below:

The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting where they can be protected and given special care is called

What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism?

Which one of the following can be explained on the basis of Mendel's Law of Dominance?

Which one of the following is not a criterion for classification of fungi?

Given below are two statements: Statement I : Bt toxins are insect group specific and coded by a gene cry IAc. Statement II : Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect the inactive protoxin gets converted into active form due to acidic pH of the insect gut. In the light of the above statements, choose the correct answer from the options given below:

Bulliform cells are responsible for

A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?

How many molecules of ATP and NADPH are required for every molecule of $C{O}_2$ fixed in the Calvin cycle?

Identify the correct description about the given figure:

Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?

Read the following statements and choose the set of correct statements: In the members of Phaeophyceae, A. Asexual reproduction occurs usually by biflagellate zoospores. B. Sexual reproduction is by oogamous method only. C. Stored food is in the form of carbohydrates which is either mannitol or laminarin. D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll. E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin. Choose the correct answer from the options given below:

Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.

Given below are two statements: Statement I: In C₃ plants, some O₂ binds to RuBisCO, hence CO₂ fixation is decreased. Statement II: In C₄ plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration. In the light of the above statements, choose the correct answer from the options given below:

The DNA present in chloroplast is:

In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is $100x$ (kcal m${}^{-2}$ yr${}^{-1}$), what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?

Which of the following are fused in somatic hybridization involving two varieties of plants?

Which of the following statement is correct regarding the process of replication in $E.coli$?

Which of the following statements is incorrect?

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'

Match List I with List II : List I (Sub Phases of Prophase I) A. Diakinesis B. Pachytene C. Zygotene D. Leptotene List II (Specific Characters) I. Synaptonemal complex formation II. Completion of terminalisation of chiasmata III. Chromosomes look like thin threads IV. Appearance of recombination nodules Choose the correct answer from the options given below

Match List I with List II

Match List I with List II : List I A. Axoneme B. Cartwheel pattern C. Crista D. Satellite List II I. Centriole II. Cilia and flagella III. Chromosome IV. Mitochondria Choose the correct answer from the options given below :

Match List I with List II : List I A. α –I antitrypsin B. Cry IAb C. Cry IAc D Enzyme replacement therapy List II I. Cotton bollworm II. ADA deficiency III. Emphysema IV Corn borer Choose the correct answer form the options given below: (1) A-II, B-I, C-IV, D-III (2) A-III, B-I, C-II, D-IV (3) A-III, B-IV, C-I, D-II (4) A-II, B-IV, C-I, D-III

The “Ti plasmid” of Agrobacterium tumefaciens stands for (1) Tumour inhibiting plasmid (2) Tumor independent plasmid (3) Tumor inducing plasmid (4) Temperature independent plasmid

Following are the stages of cell division: A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1 phase Choose the correct sequence of stages from the options given below:

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

Match List I with List II :

The following diagram showing restriction sites in E. coli cloning vector pBR322. Find the role of 'X' and 'Y' genes :

Match List I with List II :

Match List I with List II :

Given below are two statements: Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely. Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting. In the light of the above statements, choose the correct answer from the options given below : (1) Both Statement I and Statement II are true. (2) Both Statement I and Statement II are false. (3) Statement I is true but Statement II is false. (4) Statement I is false but Statement II is true.

Given below are two statements: Statement I: Mitochondria and chloroplasts both double membranes bound organelles. Statement II: Inner membrane of mitochondria is relatively less permeable, as compared chloroplast. In the light of the above statements, choose the mis appropriate answer from the options given below:

As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective genotype can be

Match List I with List II:

Lecithin, a small molecular weight organic compound found in living tissues, is an example of: